Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000733.1

Orthogroup ID

OG0017691

Physical Location & Seq

Genomic Coordinates Reverse (-)

62571 .. 62915

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000733.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atgcaacaatttgctgtgaggttttttagtagtctcttcttagctgagattagtctggatctccgatttcacattcctatactttttccagatgttaatgttactgatcttaatctgatgggtaggcctatctcggatactgaaattcataatgctctttttagaattggaagacttaaagcacctggtgttgatggatttcctgccttattctatcaacaacattggcccctttgctcctctgagattatcaaggttgtcaattctgcatttcagattggtacaatccctcctggccttaatcacactcttattactttagtcccaaaagtttctgctccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

114

Amino Acids

12.73

Weight (kDa)

6.9

Isoelectric Point (pI)

41.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017691)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g18163
rosa_multiflora	Rmu_co8106108.1_g000001 Rmu_sc0000324.1_g000008 Rmu_sc0000367.1_g000089 Rmu_sc0000733.1_g000013 Rmu_sc0001152.1_g000050 Rmu_sc0001227.1_g000003 Rmu_sc0002194.1_g000036 Rmu_sc0002557.1_g000015 Rmu_sc0005339.1_g000007 Rmu_sc0012746.1_g000024 Rmu_sc0028686.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	66
AcsI	RAATTY	1 cut(s)	144
AdeI	CACNNNGTG	1 cut(s)	188
AfaI	GTAC	1 cut(s)	283
AjnI	CCWGG	2 cut(s)	184, 292
AluBI	AGCT	1 cut(s)	44
AluI	AGCT	1 cut(s)	44
Alw26I	GTCTC	1 cut(s)	38
AlwI	GGATC	1 cut(s)	66
AoxI	GGCC	3 cut(s)	125, 227, 295
ApoI	RAATTY	1 cut(s)	144
AspS9I	GGNCC	1 cut(s)	228
BbsI	GAAGAC	1 cut(s)	178
BccI	CCATC	2 cut(s)	112, 188
BciT130I	CCWGG	2 cut(s)	186, 294
BciVI	GTATCC	1 cut(s)	130
BcoDI	GTCTC	1 cut(s)	38
BfuI	GTATCC	1 cut(s)	130
Bme1390I	CCNGG	2 cut(s)	186, 294
BmgT120I	GGNCC	1 cut(s)	228
BmiI	GGNNCC	1 cut(s)	230
BmrFI	CCNGG	2 cut(s)	186, 294
BpiI	GAAGAC	1 cut(s)	178
BsaBI	GATNNNNATC	1 cut(s)	111
BsaXI	ACNNNNNCTCC	2 cut(s)	274, 304
Bse8I	GATNNNNATC	1 cut(s)	111
BseBI	CCWGG	2 cut(s)	186, 294
BseJI	GATNNNNATC	1 cut(s)	111
BseMII	CTCAG	2 cut(s)	36, 234
BseRI	GAGGAG	1 cut(s)	229
BshFI	GGCC	3 cut(s)	127, 229, 297
BslFI	GGGAC	1 cut(s)	308
BsmAI	GTCTC	1 cut(s)	38
BsmFI	GGGAC	1 cut(s)	308
BsnI	GGCC	3 cut(s)	127, 229, 297
Bsp143I	GATC	2 cut(s)	58, 106
BspANI	GGCC	3 cut(s)	127, 229, 297
BspCNI	CTCAG	2 cut(s)	37, 235
BspLI	GGNNCC	1 cut(s)	230
BspPI	GGATC	1 cut(s)	66
BssMI	GATC	2 cut(s)	58, 106
Bst2UI	CCWGG	2 cut(s)	186, 294
Bst6I	CTCTTC	1 cut(s)	41
BstDEI	CTNAG	3 cut(s)	40, 45, 243
BstKTI	GATC	2 cut(s)	61, 109
BstMAI	GTCTC	1 cut(s)	38
BstMBI	GATC	2 cut(s)	58, 106
BstNI	CCWGG	2 cut(s)	186, 294
BstSCI	CCNGG	2 cut(s)	184, 292
BstV2I	GAAGAC	1 cut(s)	178
BstX2I	RGATCY	1 cut(s)	58
BstYI	RGATCY	1 cut(s)	58
BsuI	GTATCC	1 cut(s)	130
BsuRI	GGCC	3 cut(s)	127, 229, 297
Cfr13I	GGNCC	1 cut(s)	228
CsiI	ACCWGGT	1 cut(s)	184
Csp6I	GTAC	1 cut(s)	282
CviJI	RGCY	4 cut(s)	44, 127, 229, 297
CviKI_1	RGCY	4 cut(s)	44, 127, 229, 297
CviQI	GTAC	1 cut(s)	282
DdeI	CTNAG	3 cut(s)	40, 45, 243
DpnI	GATC	2 cut(s)	60, 108
DpnII	GATC	2 cut(s)	58, 106
DraIII	CACNNNGTG	1 cut(s)	188
Eam1104I	CTCTTC	1 cut(s)	41
EarI	CTCTTC	1 cut(s)	41
Eco147I	AGGCCT	1 cut(s)	127
EcoRII	CCWGG	2 cut(s)	184, 292
FaiI	YATR	3 cut(s)	80, 150, 343
FaqI	GGGAC	1 cut(s)	308
HaeIII	GGCC	3 cut(s)	127, 229, 297
Hpy188I	TCNGA	5 cut(s)	65, 117, 136, 244, 276
Hpy188III	TCNNGA	2 cut(s)	56, 89
HpyCH4V	TGCA	2 cut(s)	4, 269
HpyF3I	CTNAG	3 cut(s)	40, 45, 243
Kzo9I	GATC	2 cut(s)	58, 106
LmnI	GCTCC	2 cut(s)	242, 343
LpnPI	CCDG	7 cut(s)	41, 102, 171, 198, 216, 279, 306
MabI	ACCWGGT	1 cut(s)	184
MaeIII	GTNAC	1 cut(s)	100
MalI	GATC	2 cut(s)	60, 108
MboI	GATC	2 cut(s)	58, 106
MboII	GAAGA	2 cut(s)	28, 183
MflI	RGATCY	1 cut(s)	58
MluCI	AATT	4 cut(s)	8, 144, 165, 262
MnlI	CCTC	3 cut(s)	12, 250, 300
MseI	TTAA	4 cut(s)	96, 111, 177, 300
MspR9I	CCNGG	2 cut(s)	186, 294
MvaI	CCWGG	2 cut(s)	186, 294
NdeII	GATC	2 cut(s)	58, 106
NlaIV	GGNNCC	1 cut(s)	230
PceI	AGGCCT	1 cut(s)	127
Psp6I	CCWGG	2 cut(s)	184, 292
PspGI	CCWGG	2 cut(s)	184, 292
PspN4I	GGNNCC	1 cut(s)	230
PspPI	GGNCC	1 cut(s)	228
PsuI	RGATCY	1 cut(s)	58
RsaI	GTAC	1 cut(s)	283
RsaNI	GTAC	1 cut(s)	282
SaqAI	TTAA	4 cut(s)	96, 111, 177, 300
Sau3AI	GATC	2 cut(s)	58, 106
Sau96I	GGNCC	1 cut(s)	228
ScrFI	CCNGG	2 cut(s)	186, 294
SetI	ASST	4 cut(s)	23, 46, 187, 258
SexAI	ACCWGGT	1 cut(s)	184
SgeI	CNNG	9 cut(s)	68, 101, 145, 197, 198, 215, 265, 305, 306
Sse9I	AATT	4 cut(s)	8, 144, 165, 262
SseBI	AGGCCT	1 cut(s)	127
StuI	AGGCCT	1 cut(s)	127
StyD4I	CCNGG	2 cut(s)	184, 292
TasI	AATT	4 cut(s)	8, 144, 165, 262
Tru1I	TTAA	4 cut(s)	96, 111, 177, 300
Tru9I	TTAA	4 cut(s)	96, 111, 177, 300
TspDTI	ATGAA	1 cut(s)	137
XapI	RAATTY	1 cut(s)	144

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.