Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001152.1

Orthogroup ID

OG0017691

Physical Location & Seq

Genomic Coordinates Reverse (-)

207518 .. 208171

Gene Structure 654 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001152.1_g000050.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 654 bp

atgcacaaggttttctggaaacaaaaatcgagaaatacttggttgcgagaaggggataagaacaccagtttctttcatctgtccaccattattcgtagaagaagaaacagaattgaaggtcttgaagatgagaatgacatttggagaactgattggagaactgatagagatgacctgcatattatggctgtgaactatttcaaggggttattcagagagaagaatactataggagtgagtgaagctattcctaatctgttcccaagaatagaaccaagcgatcttggtgacctcagtcgtgatgtttttgaagaagaaataaagaatagtatgttctccattagtggtctcaaagcaccaggcccagatggaattcctgcaaagtttttccaggttcattggtcgacatgtaaagatgacattattaagatagttaaagagtgctttgataaatgcgagcttcctgagaatctgaataacacactcattgccttaattcccaaagtggcaagccctctctctatgaagcagacgcgaccaactagtctttgcaatactttatataaagtggtctcaaagattattgtgcaaagattaaggtctatgaggagtacgatggtctctcctacacatgttagttttattcctggctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

217

Amino Acids

25.18

Weight (kDa)

9.32

Isoelectric Point (pI)

47.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017691)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g18163
rosa_multiflora	Rmu_co8106108.1_g000001 Rmu_sc0000324.1_g000008 Rmu_sc0000367.1_g000089 Rmu_sc0000733.1_g000013 Rmu_sc0001152.1_g000050 Rmu_sc0001227.1_g000003 Rmu_sc0002194.1_g000036 Rmu_sc0002557.1_g000015 Rmu_sc0005339.1_g000007 Rmu_sc0012746.1_g000024 Rmu_sc0028686.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	543
Acc36I	ACCTGC	1 cut(s)	183
AccI	GTMKAC	1 cut(s)	404
AccII	CGCG	1 cut(s)	535
AcsI	RAATTY	1 cut(s)	372
AfaI	GTAC	1 cut(s)	613
AflIII	ACRYGT	2 cut(s)	407, 631
AgsI	TTSAA	4 cut(s)	116, 125, 202, 311
AhlI	ACTAGT	1 cut(s)	542
AjnI	CCWGG	3 cut(s)	358, 390, 646
AluBI	AGCT	2 cut(s)	245, 460
AluI	AGCT	2 cut(s)	245, 460
Alw26I	GTCTC	3 cut(s)	353, 577, 625
AoxI	GGCC	1 cut(s)	361
ApoI	RAATTY	1 cut(s)	372
Asp700I	GAANNNNTTC	2 cut(s)	197, 246
AspS9I	GGNCC	1 cut(s)	362
AsuHPI	GGTGA	1 cut(s)	299
BccI	CCATC	2 cut(s)	362, 610
BciT130I	CCWGG	3 cut(s)	360, 392, 648
BcoDI	GTCTC	3 cut(s)	353, 577, 625
BcuI	ACTAGT	1 cut(s)	542
BfaI	CTAG	1 cut(s)	543
BfmI	CTRYAG	1 cut(s)	228
BfuAI	ACCTGC	1 cut(s)	183
Bme1390I	CCNGG	3 cut(s)	360, 392, 648
BmgT120I	GGNCC	1 cut(s)	362
BmrFI	CCNGG	3 cut(s)	360, 392, 648
BoxI	GACNNNNGTC	1 cut(s)	294
BsaI	GGTCTC	3 cut(s)	353, 577, 625
Bse1I	ACTGG	1 cut(s)	66
Bse3DI	GCAATG	1 cut(s)	486
BseBI	CCWGG	3 cut(s)	360, 392, 648
BseMI	GCAATG	1 cut(s)	486
BseMII	CTCAG	2 cut(s)	307, 456
BseNI	ACTGG	1 cut(s)	66
BseRI	GAGGAG	1 cut(s)	622
Bsh1236I	CGCG	1 cut(s)	535
BshFI	GGCC	1 cut(s)	363
BsmAI	GTCTC	3 cut(s)	353, 577, 625
BsnI	GGCC	1 cut(s)	363
Bso31I	GGTCTC	3 cut(s)	353, 577, 625
Bsp143I	GATC	1 cut(s)	280
BspANI	GGCC	1 cut(s)	363
BspCNI	CTCAG	2 cut(s)	306, 457
BspFNI	CGCG	1 cut(s)	535
BspMI	ACCTGC	1 cut(s)	183
BspTNI	GGTCTC	3 cut(s)	353, 577, 625
BsrDI	GCAATG	1 cut(s)	486
BsrI	ACTGG	1 cut(s)	66
BssMI	GATC	1 cut(s)	280
Bst2UI	CCWGG	3 cut(s)	360, 392, 648
BstC8I	GCNNGC	2 cut(s)	458, 511
BstDEI	CTNAG	2 cut(s)	293, 465
BstEII	GGTNACC	1 cut(s)	287
BstFNI	CGCG	1 cut(s)	535
BstKTI	GATC	1 cut(s)	283
BstMAI	GTCTC	3 cut(s)	353, 577, 625
BstMBI	GATC	1 cut(s)	280
BstNI	CCWGG	3 cut(s)	360, 392, 648
BstNSI	RCATGY	2 cut(s)	411, 635
BstPAI	GACNNNNGTC	1 cut(s)	294
BstPI	GGTNACC	1 cut(s)	287
BstSCI	CCNGG	3 cut(s)	358, 390, 646
BstSFI	CTRYAG	1 cut(s)	228
BstUI	CGCG	1 cut(s)	535
BsuRI	GGCC	1 cut(s)	363
BveI	ACCTGC	1 cut(s)	183
Cac8I	GCNNGC	2 cut(s)	458, 511
Cfr13I	GGNCC	1 cut(s)	362
CseI	GACGC	1 cut(s)	541
Csp6I	GTAC	1 cut(s)	612
CviAII	CATG	2 cut(s)	408, 632
CviJI	RGCY	6 cut(s)	188, 245, 363, 460, 513, 651
CviKI_1	RGCY	6 cut(s)	188, 245, 363, 460, 513, 651
CviQI	GTAC	1 cut(s)	612
DdeI	CTNAG	2 cut(s)	293, 465
DpnI	GATC	1 cut(s)	282
DpnII	GATC	1 cut(s)	280
DrdI	GACNNNNNNGTC	1 cut(s)	543
DseDI	GACNNNNNNGTC	1 cut(s)	543
Eco31I	GGTCTC	3 cut(s)	353, 577, 625
Eco91I	GGTNACC	1 cut(s)	287
EcoO65I	GGTNACC	1 cut(s)	287
EcoRI	GAATTC	1 cut(s)	372
EcoRII	CCWGG	3 cut(s)	358, 390, 646
FaeI	CATG	2 cut(s)	411, 635
FatI	CATG	2 cut(s)	407, 631
FblI	GTMKAC	1 cut(s)	404
FspBI	CTAG	1 cut(s)	543
HaeIII	GGCC	1 cut(s)	363
HgaI	GACGC	1 cut(s)	541
Hin1II	CATG	2 cut(s)	411, 635
HincII	GTYRAC	1 cut(s)	405
HindII	GTYRAC	1 cut(s)	405
HinfI	GANTC	1 cut(s)	469
HphI	GGTGA	1 cut(s)	299
Hpy166II	GTNNAC	3 cut(s)	84, 193, 405
Hpy188I	TCNGA	2 cut(s)	215, 474
Hpy188III	TCNNGA	5 cut(s)	16, 30, 122, 299, 464
Hpy8I	GTNNAC	3 cut(s)	84, 193, 405
HpyAV	CCTTC	2 cut(s)	44, 110
HpyCH4V	TGCA	5 cut(s)	4, 178, 380, 552, 589
HpyF3I	CTNAG	2 cut(s)	293, 465
Hsp92II	CATG	2 cut(s)	411, 635
Kzo9I	GATC	1 cut(s)	280
MaeI	CTAG	1 cut(s)	543
MaeIII	GTNAC	1 cut(s)	287
MalI	GATC	1 cut(s)	282
MboI	GATC	1 cut(s)	280
MboII	GAAGA	6 cut(s)	111, 114, 137, 232, 323, 326
MluCI	AATT	3 cut(s)	111, 372, 495
MnlI	CCTC	3 cut(s)	302, 525, 600
MroXI	GAANNNNTTC	2 cut(s)	197, 246
MseI	TTAA	4 cut(s)	426, 435, 494, 596
MspR9I	CCNGG	3 cut(s)	360, 392, 648
MvaI	CCWGG	3 cut(s)	360, 392, 648
MvnI	CGCG	1 cut(s)	535
NdeII	GATC	1 cut(s)	280
NlaIII	CATG	2 cut(s)	411, 635
NmuCI	GTSAC	1 cut(s)	287
NspI	RCATGY	2 cut(s)	411, 635
PciI	ACATGT	2 cut(s)	407, 631
PdmI	GAANNNNTTC	2 cut(s)	197, 246
PfeI	GAWTC	1 cut(s)	469
PscI	ACATGT	2 cut(s)	407, 631
PshAI	GACNNNNGTC	1 cut(s)	294
Psp6I	CCWGG	3 cut(s)	358, 390, 646
PspEI	GGTNACC	1 cut(s)	287
PspGI	CCWGG	3 cut(s)	358, 390, 646
PspPI	GGNCC	1 cut(s)	362
RsaI	GTAC	1 cut(s)	613
RsaNI	GTAC	1 cut(s)	612
SalI	GTCGAC	1 cut(s)	403
SaqAI	TTAA	4 cut(s)	426, 435, 494, 596
Sau3AI	GATC	1 cut(s)	280
Sau96I	GGNCC	1 cut(s)	362
ScrFI	CCNGG	3 cut(s)	360, 392, 648
SetI	ASST	8 cut(s)	12, 121, 177, 247, 294, 396, 462, 602
SfcI	CTRYAG	1 cut(s)	228
SpeI	ACTAGT	1 cut(s)	542
Sse9I	AATT	3 cut(s)	111, 372, 495
SspMI	CTAG	1 cut(s)	543
StyD4I	CCNGG	3 cut(s)	358, 390, 646
TaqI	TCGA	2 cut(s)	29, 404
TasI	AATT	3 cut(s)	111, 372, 495
TfiI	GAWTC	1 cut(s)	469
Tru1I	TTAA	4 cut(s)	426, 435, 494, 596
Tru9I	TTAA	4 cut(s)	426, 435, 494, 596
TseFI	GTSAC	1 cut(s)	287
Tsp45I	GTSAC	1 cut(s)	287
TspDTI	ATGAA	3 cut(s)	65, 386, 539
XapI	RAATTY	1 cut(s)	372
XceI	RCATGY	2 cut(s)	411, 635
XmiI	GTMKAC	1 cut(s)	404
XmnI	GAANNNNTTC	2 cut(s)	197, 246
XspI	CTAG	1 cut(s)	543

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.