Rmu_sc0002194.1_g000036

acid phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002194.1
OG0017691
Physical Location & Seq
Forward (+)
114696 .. 115414
719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002194.1_g000036.1.cds

Sequence Viewer

Length: 615 bp
atgataagtctacccagctttccagagctctttctaagtggtttcaagatgtttatggaaagattttcagtaaagaaagaagatttctggcaagacttggtggtattcagaaaaggtttgaagaatcttgaagaaaccttaaccaaggagtatgatcttctttgtaatcaagaagcaattttgtggcaacaaaagtcaagggataaatggcttaagaatgctgatcaaaacactattgtttcacttaactaccatgatgaggtggaaagaagaacaagattgaagggatatatgattatacctcatccttttcccatcctcaatcctttggatgtgcaaaatctgcaaaaggaggtaagccaacttgcagttatgatggctatatctaacactggagggctcaagtctccaggacttgatagctttcctgcctttcttcaccaaaagcattggaatttgtatgaaactgagatcgctgagattgtaaagtctgcattcaaatcagggatttttcattctggtctgaaccataccatcatcaccctgattcccgaaactcagaatccttataatgttacccaatttagacctatacgtcttcaaactactttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

204

Amino Acids

23.82

Weight (kDa)

7.85

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 570
AasI GACNNNNNNGTC 1 cut(s) 594
AccI GTMKAC 1 cut(s) 10
AcsI RAATTY 1 cut(s) 454
AfiI CCNNNNNNNGG 1 cut(s) 259
AflII CTTAAG 1 cut(s) 212
AgsI TTSAA 6 cut(s) 46, 121, 131, 283, 499, 602
AjnI CCWGG 1 cut(s) 409
AluBI AGCT 3 cut(s) 18, 28, 423
AluI AGCT 3 cut(s) 18, 28, 423
Alw21I GWGCWC 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 411
ApoI RAATTY 1 cut(s) 454
AsuHPI GGTGA 2 cut(s) 431, 532
BanII GRGCYC 2 cut(s) 30, 402
BbsI GAAGAC 1 cut(s) 590
Bbv12I GWGCWC 1 cut(s) 30
BccI CCATC 3 cut(s) 323, 370, 542
BciT130I CCWGG 1 cut(s) 411
BclI TGATCA 1 cut(s) 223
BcoDI GTCTC 1 cut(s) 411
BfrI CTTAAG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 411
BmrFI CCNGG 1 cut(s) 411
BpiI GAAGAC 1 cut(s) 590
BpmI CTGGAG 2 cut(s) 393, 414
BpuEI CTTGAG 1 cut(s) 386
BsaJI CCNNGG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 397
BseBI CCWGG 1 cut(s) 411
BseDI CCNNGG 1 cut(s) 144
BseGI GGATG 3 cut(s) 304, 315, 337
BseLI CCNNNNNNNGG 1 cut(s) 259
BseMII CTCAG 3 cut(s) 459, 468, 572
BseNI ACTGG 1 cut(s) 397
BseYI CCCAGC 1 cut(s) 14
BsiHKAI GWGCWC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 411
BsmI GAATGC 2 cut(s) 223, 494
Bsp1286I GDGCHC 2 cut(s) 30, 402
Bsp143I GATC 3 cut(s) 154, 223, 471
BspCNI CTCAG 3 cut(s) 460, 469, 571
BspTI CTTAAG 1 cut(s) 212
BsrI ACTGG 1 cut(s) 397
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 3 cut(s) 154, 223, 471
BssT1I CCWWGG 1 cut(s) 144
Bst2UI CCWGG 1 cut(s) 411
BstAFI CTTAAG 1 cut(s) 212
BstAPI GCANNNNNTGC 1 cut(s) 343
BstDEI CTNAG 4 cut(s) 35, 468, 477, 558
BstF5I GGATG 3 cut(s) 304, 315, 337
BstKTI GATC 3 cut(s) 157, 226, 474
BstMAI GTCTC 1 cut(s) 411
BstMBI GATC 3 cut(s) 154, 223, 471
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstNI CCWGG 1 cut(s) 411
BstSCI CCNGG 1 cut(s) 409
BstV2I GAAGAC 1 cut(s) 590
BtsCI GGATG 3 cut(s) 304, 315, 337
BtsIMutI CAGTG 1 cut(s) 390
CviAII CATG 1 cut(s) 254
CviJI RGCY 7 cut(s) 18, 28, 211, 360, 380, 400, 423
CviKI_1 RGCY 7 cut(s) 18, 28, 211, 360, 380, 400, 423
DdeI CTNAG 4 cut(s) 35, 468, 477, 558
DpnI GATC 3 cut(s) 156, 225, 473
DpnII GATC 3 cut(s) 154, 223, 471
DrdI GACNNNNNNGTC 1 cut(s) 594
DseDI GACNNNNNNGTC 1 cut(s) 594
Ecl136II GAGCTC 1 cut(s) 28
Eco130I CCWWGG 1 cut(s) 144
Eco24I GRGCYC 2 cut(s) 30, 402
Eco53kI GAGCTC 1 cut(s) 28
EcoICRI GAGCTC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 409
EcoT14I CCWWGG 1 cut(s) 144
EcoT38I GRGCYC 2 cut(s) 30, 402
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 257
FatI CATG 1 cut(s) 253
FbaI TGATCA 1 cut(s) 223
FblI GTMKAC 1 cut(s) 10
FokI GGATG 3 cut(s) 291, 302, 344
FriOI GRGCYC 2 cut(s) 30, 402
GsaI CCCAGC 1 cut(s) 18
GsuI CTGGAG 2 cut(s) 393, 414
Hin1II CATG 1 cut(s) 257
HinfI GANTC 3 cut(s) 124, 547, 562
HphI GGTGA 2 cut(s) 431, 532
Hpy166II GTNNAC 1 cut(s) 11
Hpy188I TCNGA 3 cut(s) 110, 525, 561
Hpy188III TCNNGA 5 cut(s) 23, 46, 128, 170, 551
Hpy8I GTNNAC 1 cut(s) 11
HpyAV CCTTC 1 cut(s) 277
HpyCH4IV ACGT 1 cut(s) 595
HpyCH4V TGCA 4 cut(s) 337, 346, 368, 494
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
HpyF3I CTNAG 4 cut(s) 35, 468, 477, 558
HpySE526I ACGT 1 cut(s) 595
Hsp92II CATG 1 cut(s) 257
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 3 cut(s) 154, 223, 471
MaeII ACGT 1 cut(s) 595
MaeIII GTNAC 1 cut(s) 574
MalI GATC 3 cut(s) 156, 225, 473
MboI GATC 3 cut(s) 154, 223, 471
MboII GAAGA 7 cut(s) 92, 133, 143, 149, 282, 428, 590
MhlI GDGCHC 2 cut(s) 30, 402
MluCI AATT 3 cut(s) 177, 454, 581
MnlI CCTC 5 cut(s) 253, 312, 329, 346, 389
MseI TTAA 3 cut(s) 140, 213, 246
MspCI CTTAAG 1 cut(s) 212
MspR9I CCNGG 1 cut(s) 411
Mva1269I GAATGC 2 cut(s) 223, 494
MvaI CCWGG 1 cut(s) 411
MwoI GCNNNNNNNGC 1 cut(s) 343
NdeII GATC 3 cut(s) 154, 223, 471
NlaIII CATG 1 cut(s) 257
PctI GAATGC 2 cut(s) 223, 494
PfeI GAWTC 3 cut(s) 124, 547, 562
PfoI TCCNGGA 1 cut(s) 409
PsiI TTATAA 1 cut(s) 570
Psp124BI GAGCTC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 409
PspFI CCCAGC 1 cut(s) 14
PspGI CCWGG 1 cut(s) 409
SacI GAGCTC 1 cut(s) 30
SaqAI TTAA 3 cut(s) 140, 213, 246
Sau3AI GATC 3 cut(s) 154, 223, 471
ScrFI CCNGG 1 cut(s) 411
SduI GDGCHC 2 cut(s) 30, 402
SmlI CTYRAG 2 cut(s) 212, 401
SmoI CTYRAG 2 cut(s) 212, 401
Sse9I AATT 3 cut(s) 177, 454, 581
SstI GAGCTC 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 409
StyI CCWWGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 598
TasI AATT 3 cut(s) 177, 454, 581
TfiI GAWTC 3 cut(s) 124, 547, 562
Tru1I TTAA 3 cut(s) 140, 213, 246
Tru9I TTAA 3 cut(s) 140, 213, 246
TscAI CASTG 1 cut(s) 397
TspDTI ATGAA 2 cut(s) 477, 503
TspRI CASTG 1 cut(s) 397
Vha464I CTTAAG 1 cut(s) 212
XapI RAATTY 1 cut(s) 454
XmiI GTMKAC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.