FvH4_6g35910
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
28306286 .. 28309608
3323 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g35910.t2

Sequence Viewer

Length: 234 bp
ATGGCAACTGGTGAGGTTTTGTTCCCTGCTGATCCTACTTCTCACCCCCGTACCCATCTCCAAAACATATATAGACGCTTGGGCACTCCATCTGAGAACCCCTATCCTTCTGATGTGAAGGATCAGTGGGATACCCAGAAGACTATTAGGCCTACCCTTAATCTCTATGCTCGCCTGTTACCATTGTTTGGCCAGTCAGGATCTGAGCTTGTTAATGGGATTGTTGTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.63

Weight (kDa)

6.71

Isoelectric Point (pI)

43.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AclWI GGATC 3 cut(s) 26, 129, 208
AcoI YGGCCR 1 cut(s) 190
AfaI GTAC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 188
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
AlwI GGATC 3 cut(s) 26, 129, 208
AlwNI CAGNNNCTG 1 cut(s) 203
AoxI GGCC 2 cut(s) 149, 190
AsuHPI GGTGA 2 cut(s) 23, 35
BaeGI GKGCMC 1 cut(s) 86
BaeI ACNNNNGTAYC 2 cut(s) 34, 67
BalI TGGCCA 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 146
BccI CCATC 2 cut(s) 63, 97
BciVI GTATCC 1 cut(s) 124
BfuI GTATCC 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 2 cut(s) 13, 193
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 2 cut(s) 84, 195
BseNI ACTGG 2 cut(s) 13, 193
BseSI GKGCMC 1 cut(s) 86
BshFI GGCC 2 cut(s) 151, 192
BslI CCNNNNNNNGG 1 cut(s) 188
BsnI GGCC 2 cut(s) 151, 192
Bsp1286I GDGCHC 1 cut(s) 86
Bsp143I GATC 3 cut(s) 31, 121, 200
BspANI GGCC 2 cut(s) 151, 192
BspCNI CTCAG 2 cut(s) 85, 196
BspPI GGATC 3 cut(s) 26, 129, 208
BsrI ACTGG 2 cut(s) 13, 193
BssMI GATC 3 cut(s) 31, 121, 200
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 2 cut(s) 93, 204
BstKTI GATC 3 cut(s) 34, 124, 203
BstMBI GATC 3 cut(s) 31, 121, 200
BstSLI GKGCMC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 146
BstX2I RGATCY 1 cut(s) 200
BstYI RGATCY 1 cut(s) 200
BsuI GTATCC 1 cut(s) 124
BsuRI GGCC 2 cut(s) 151, 192
BtsIMutI CAGTG 1 cut(s) 131
Cac8I GCNNGC 1 cut(s) 172
CaiI CAGNNNCTG 1 cut(s) 203
CseI GACGC 1 cut(s) 84
Csp6I GTAC 1 cut(s) 51
CviJI RGCY 3 cut(s) 151, 192, 208
CviKI_1 RGCY 3 cut(s) 151, 192, 208
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 2 cut(s) 93, 204
DpnI GATC 3 cut(s) 33, 123, 202
DpnII GATC 3 cut(s) 31, 121, 200
EaeI YGGCCR 1 cut(s) 190
Eco147I AGGCCT 1 cut(s) 151
FaiI YATR 4 cut(s) 68, 70, 72, 168
HaeIII GGCC 2 cut(s) 151, 192
HgaI GACGC 1 cut(s) 84
HphI GGTGA 2 cut(s) 23, 35
Hpy188I TCNGA 3 cut(s) 94, 112, 205
Hpy188III TCNNGA 1 cut(s) 198
HpyAV CCTTC 2 cut(s) 112, 117
HpyF3I CTNAG 2 cut(s) 93, 204
Kzo9I GATC 3 cut(s) 31, 121, 200
LpnPI CCDG 5 cut(s) 39, 149, 183, 188, 206
MaeIII GTNAC 1 cut(s) 177
MalI GATC 3 cut(s) 33, 123, 202
MboI GATC 3 cut(s) 31, 121, 200
MboII GAAGA 1 cut(s) 151
MflI RGATCY 1 cut(s) 200
MhlI GDGCHC 1 cut(s) 86
MlsI TGGCCA 1 cut(s) 192
MluNI TGGCCA 1 cut(s) 192
MnlI CCTC 1 cut(s) 7
Mox20I TGGCCA 1 cut(s) 192
MscI TGGCCA 1 cut(s) 192
MseI TTAA 2 cut(s) 159, 213
Msp20I TGGCCA 1 cut(s) 192
NdeII GATC 3 cut(s) 31, 121, 200
PceI AGGCCT 1 cut(s) 151
PflMI CCANNNNNTGG 1 cut(s) 188
PstNI CAGNNNCTG 1 cut(s) 203
PsuI RGATCY 1 cut(s) 200
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SaqAI TTAA 2 cut(s) 159, 213
Sau3AI GATC 3 cut(s) 31, 121, 200
SduI GDGCHC 1 cut(s) 86
SetI ASST 2 cut(s) 18, 210
SseBI AGGCCT 1 cut(s) 151
StuI AGGCCT 1 cut(s) 151
Tru1I TTAA 2 cut(s) 159, 213
Tru9I TTAA 2 cut(s) 159, 213
TscAI CASTG 1 cut(s) 131
TspRI CASTG 1 cut(s) 131
Van91I CCANNNNNTGG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.