FvH4_6g39780

TIFY 5A-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
31396779 .. 31398550
1772 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g39780.t2

Sequence Viewer

Length: 372 bp
ATGGCAATGGAGAAATGCAGCTCGGAGGAGCTGGAACTCGGCCTTCCTCCGACGACAATCGATTCTATATCACAGATGATTTACCGGAAAGCTATTATGGATGAGCAGACCAGACAGGAACCTATCACCATTTTTTACGATGGCCGGGTTTATGTTTTCGACATCATAGAACTTCAGGTTAGAGCCATGATCTTGTTTGCAACTAGAGAAATGGAAGGAGGGATGACATCAAGGTCCTCCAAGGAAGCAATATCACTTGCATTGCAATCTCAAATACTCGGTCCTCCATGCGGATCCGTGAAGAAATCTCTCCACACATTTCTGCAAAAAAGAAAGAACGAAGCTTCTGATCCCTACAGCCACAATATATAG

Protein Analysis

124

Amino Acids

13.92

Weight (kDa)

5.69

Isoelectric Point (pI)

68.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 232
AciI CCGC 1 cut(s) 291
AclWI GGATC 3 cut(s) 288, 301, 344
AcoI YGGCCR 1 cut(s) 142
AcuI CTGAAG 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 290
AluBI AGCT 4 cut(s) 21, 31, 92, 344
AluI AGCT 4 cut(s) 21, 31, 92, 344
AlwI GGATC 3 cut(s) 288, 301, 344
AoxI GGCC 2 cut(s) 40, 142
ApeKI GCWGC 1 cut(s) 18
ArsI GACNNNNNNTTYG 2 cut(s) 265, 297
AspS9I GGNCC 2 cut(s) 234, 281
AsuC2I CCSGG 1 cut(s) 146
AsuHPI GGTGA 1 cut(s) 118
AvaII GGWCC 2 cut(s) 234, 281
BamHI GGATCC 1 cut(s) 293
BbvI GCAGC 1 cut(s) 30
BccI CCATC 1 cut(s) 134
BcnI CCSGG 1 cut(s) 146
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 355
BisI GCNGC 1 cut(s) 19
BlsI GCNGC 1 cut(s) 20
Bme1390I CCNGG 1 cut(s) 146
Bme18I GGWCC 2 cut(s) 234, 281
BmgT120I GGNCC 2 cut(s) 234, 281
BmiI GGNNCC 2 cut(s) 120, 295
BmrFI CCNGG 1 cut(s) 146
BpuMI CCSGG 1 cut(s) 146
Bsa29I ATCGAT 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 240
BsaWI WCCGGW 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 290
Bse3DI GCAATG 2 cut(s) 12, 260
BseCI ATCGAT 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 2 cut(s) 106, 228
BseLI CCNNNNNNNGG 1 cut(s) 290
BseMI GCAATG 2 cut(s) 12, 260
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 30
BshFI GGCC 2 cut(s) 42, 144
BshVI ATCGAT 1 cut(s) 60
BsiSI CCGG 2 cut(s) 85, 145
BslI CCNNNNNNNGG 1 cut(s) 290
BsnI GGCC 2 cut(s) 42, 144
Bsp143I GATC 3 cut(s) 189, 293, 349
BspACI CCGC 1 cut(s) 291
BspANI GGCC 2 cut(s) 42, 144
BspDI ATCGAT 1 cut(s) 60
BspLI GGNNCC 2 cut(s) 120, 295
BspPI GGATC 3 cut(s) 288, 301, 344
BsrDI GCAATG 2 cut(s) 12, 260
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 3 cut(s) 189, 293, 349
BssT1I CCWWGG 1 cut(s) 240
BstF5I GGATG 2 cut(s) 106, 228
BstKTI GATC 3 cut(s) 192, 296, 352
BstMBI GATC 3 cut(s) 189, 293, 349
BstSCI CCNGG 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 355
BstV1I GCAGC 1 cut(s) 30
BstX2I RGATCY 1 cut(s) 293
BstYI RGATCY 1 cut(s) 293
Bsu15I ATCGAT 1 cut(s) 60
BsuRI GGCC 2 cut(s) 42, 144
BsuTUI ATCGAT 1 cut(s) 60
BtsCI GGATG 2 cut(s) 106, 228
Cfr13I GGNCC 2 cut(s) 234, 281
ClaI ATCGAT 1 cut(s) 60
CviAII CATG 2 cut(s) 187, 288
CviJI RGCY 8 cut(s) 21, 31, 42, 92, 144, 185, 344, 360
CviKI_1 RGCY 8 cut(s) 21, 31, 42, 92, 144, 185, 344, 360
DpnI GATC 3 cut(s) 191, 295, 351
DpnII GATC 3 cut(s) 189, 293, 349
DrdI GACNNNNNNGTC 1 cut(s) 232
DseDI GACNNNNNNGTC 1 cut(s) 232
EaeI YGGCCR 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 240
Eco47I GGWCC 2 cut(s) 234, 281
Eco57I CTGAAG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 234
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 2 cut(s) 190, 291
FaiI YATR 8 cut(s) 68, 98, 153, 167, 188, 289, 368, 370
FatI CATG 2 cut(s) 186, 287
Fnu4HI GCNGC 1 cut(s) 19
FokI GGATG 2 cut(s) 113, 235
Fsp4HI GCNGC 1 cut(s) 19
FspBI CTAG 1 cut(s) 204
GluI GCNGC 1 cut(s) 19
HaeIII GGCC 2 cut(s) 42, 144
HapII CCGG 2 cut(s) 85, 145
Hin1II CATG 2 cut(s) 190, 291
HindIII AAGCTT 1 cut(s) 342
HinfI GANTC 1 cut(s) 62
HpaII CCGG 2 cut(s) 85, 145
HphI GGTGA 1 cut(s) 118
Hpy188I TCNGA 3 cut(s) 25, 51, 349
Hpy99I CGWCG 1 cut(s) 55
HpyAV CCTTC 2 cut(s) 53, 209
HpyCH4V TGCA 5 cut(s) 18, 200, 260, 265, 325
Hsp92II CATG 2 cut(s) 190, 291
Kzo9I GATC 3 cut(s) 189, 293, 349
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 6 cut(s) 17, 98, 101, 124, 158, 161
Lsp1109I GCAGC 1 cut(s) 30
MaeI CTAG 1 cut(s) 204
MalI GATC 3 cut(s) 191, 295, 351
MboI GATC 3 cut(s) 189, 293, 349
MboII GAAGA 1 cut(s) 313
MflI RGATCY 1 cut(s) 293
MmeI TCCRAC 1 cut(s) 74
MnlI CCTC 5 cut(s) 19, 57, 212, 247, 294
MspI CCGG 2 cut(s) 85, 145
MspR9I CCNGG 1 cut(s) 146
NciI CCSGG 1 cut(s) 146
NdeII GATC 3 cut(s) 189, 293, 349
NlaIII CATG 2 cut(s) 190, 291
NlaIV GGNNCC 2 cut(s) 120, 295
NmeAIII GCCGAG 1 cut(s) 18
PfeI GAWTC 1 cut(s) 62
PkrI GCNGC 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 234
Psp5II RGGWCCY 1 cut(s) 234
PspN4I GGNNCC 2 cut(s) 120, 295
PspPI GGNCC 2 cut(s) 234, 281
PspPPI RGGWCCY 1 cut(s) 234
PsuI RGATCY 1 cut(s) 293
SatI GCNGC 1 cut(s) 19
Sau3AI GATC 3 cut(s) 189, 293, 349
Sau96I GGNCC 2 cut(s) 234, 281
ScrFI CCNGG 1 cut(s) 146
SetI ASST 7 cut(s) 23, 33, 94, 124, 180, 236, 346
SfcI CTRYAG 1 cut(s) 355
SinI GGWCC 2 cut(s) 234, 281
SsiI CCGC 1 cut(s) 291
SspMI CTAG 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 144
StyI CCWWGG 1 cut(s) 240
TaqI TCGA 2 cut(s) 60, 159
TaqII GACCGA 1 cut(s) 269
TfiI GAWTC 1 cut(s) 62
TseI GCWGC 1 cut(s) 18
TspGWI ACGGA 1 cut(s) 286
VpaK11BI GGWCC 2 cut(s) 234, 281
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.