Rmu_sc0016331.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016331.1
Physical Location & Seq
Reverse (-)
1 .. 486
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016331.1_g000001.1.cds

Sequence Viewer

Length: 171 bp
atggagaaatgcagctcgaaggagttggacctcggccttcctccgatgacggtcgattctttatcacagatgatttaccggaaagctctgatggatgatccgacgagccaggaaccgatcaccattttttatgatgggcgggtttatgttttcgatatcatggaacttcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.59

Weight (kDa)

4.24

Isoelectric Point (pI)

45.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 139
AclWI GGATC 1 cut(s) 92
AcuI CTGAAG 1 cut(s) 152
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 2 cut(s) 15, 86
AluI AGCT 2 cut(s) 15, 86
AlwI GGATC 1 cut(s) 92
AoxI GGCC 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 12
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 112
AvaII GGWCC 1 cut(s) 28
BbvI GCAGC 1 cut(s) 24
BccI CCATC 2 cut(s) 85, 128
BciT130I CCWGG 1 cut(s) 110
BisI GCNGC 1 cut(s) 13
BlsI GCNGC 1 cut(s) 14
Bme1390I CCNGG 1 cut(s) 110
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 31
BsaWI WCCGGW 1 cut(s) 78
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 31
BseGI GGATG 1 cut(s) 100
BseXI GCAGC 1 cut(s) 24
Bsh1285I CGRYCG 1 cut(s) 54
BshFI GGCC 1 cut(s) 36
BsiEI CGRYCG 1 cut(s) 54
BsiSI CCGG 1 cut(s) 79
BsnI GGCC 1 cut(s) 36
Bsp143I GATC 2 cut(s) 97, 117
BspACI CCGC 1 cut(s) 139
BspANI GGCC 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 114
BspPI GGATC 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 31
BssMI GATC 2 cut(s) 97, 117
Bst2UI CCWGG 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 52
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 2 cut(s) 100, 120
BstMBI GATC 2 cut(s) 97, 117
BstMCI CGRYCG 1 cut(s) 54
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BstV1I GCAGC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 36
BtsCI GGATG 1 cut(s) 100
Cfr13I GGNCC 1 cut(s) 28
CviAII CATG 1 cut(s) 160
CviJI RGCY 4 cut(s) 15, 36, 86, 108
CviKI_1 RGCY 4 cut(s) 15, 36, 86, 108
DpnI GATC 2 cut(s) 99, 119
DpnII GATC 2 cut(s) 97, 117
Eco32I GATATC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 108
EcoRV GATATC 1 cut(s) 157
FaeI CATG 1 cut(s) 163
FaiI YATR 3 cut(s) 132, 147, 161
FatI CATG 1 cut(s) 159
FauI CCCGC 1 cut(s) 132
Fnu4HI GCNGC 1 cut(s) 13
FokI GGATG 1 cut(s) 107
Fsp4HI GCNGC 1 cut(s) 13
GluI GCNGC 1 cut(s) 13
HaeIII GGCC 1 cut(s) 36
HapII CCGG 1 cut(s) 79
Hin1II CATG 1 cut(s) 163
HinfI GANTC 1 cut(s) 56
HpaII CCGG 1 cut(s) 79
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 3 cut(s) 45, 90, 102
Hpy99I CGWCG 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 13, 47
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 12
Hsp92II CATG 1 cut(s) 163
Kzo9I GATC 2 cut(s) 97, 117
LpnPI CCDG 3 cut(s) 92, 95, 122
Lsp1109I GCAGC 1 cut(s) 24
MalI GATC 2 cut(s) 99, 119
MboI GATC 2 cut(s) 97, 117
MmeI TCCRAC 2 cut(s) 6, 125
MnlI CCTC 2 cut(s) 41, 51
MspI CCGG 1 cut(s) 79
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 2 cut(s) 97, 117
NlaIII CATG 1 cut(s) 163
NlaIV GGNNCC 1 cut(s) 114
NmeAIII GCCGAG 1 cut(s) 12
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspN4I GGNNCC 1 cut(s) 114
PspPI GGNCC 1 cut(s) 28
SatI GCNGC 1 cut(s) 13
Sau3AI GATC 2 cut(s) 97, 117
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 110
SetI ASST 3 cut(s) 17, 33, 88
SgeI CNNG 7 cut(s) 28, 44, 91, 117, 121, 122, 152
SinI GGWCC 1 cut(s) 28
SsiI CCGC 1 cut(s) 139
StyD4I CCNGG 1 cut(s) 108
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 3 cut(s) 17, 54, 153
TfiI GAWTC 1 cut(s) 56
TseI GCWGC 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.