MD00G1074700.v1.1

Lycopene beta cyclase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0007985
Physical Location & Seq
Forward (+)
14956528 .. 14956680
153 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1074700.v1.1.491

Sequence Viewer

Length: 153 bp
ATGATATTTCTTGAAGAAACTTCCCTGGTGGCTCAGCCTGGCTTACCCATGAAAGATATCCAAGAAATGATGGCTGCTAGGTTAAAGCATCTAGGCATAAAAGTTAAGAGCATTGAAGAGGATGAGCATTGTGTCATCCCAATGGGTGGATAG

Protein Analysis

51

Amino Acids

5.57

Weight (kDa)

5.11

Isoelectric Point (pI)

37.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lycopene_cycl PF05834 2 - 50 7.7e-15 Lycopene cyclase protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 2 cut(s) 14, 116
AjnI CCWGG 2 cut(s) 24, 37
ApeKI GCWGC 1 cut(s) 74
BbvI GCAGC 1 cut(s) 61
BccI CCATC 1 cut(s) 64
BciT130I CCWGG 2 cut(s) 26, 39
BfaI CTAG 2 cut(s) 78, 92
BisI GCNGC 1 cut(s) 75
BlpI GCTNAGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 76
Bme1390I CCNGG 2 cut(s) 26, 39
BmrFI CCNGG 2 cut(s) 26, 39
BmsI GCATC 1 cut(s) 97
Bpu1102I GCTNAGC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseBI CCWGG 2 cut(s) 26, 39
BseDI CCNNGG 1 cut(s) 24
BseGI GGATG 2 cut(s) 127, 135
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMII CTCAG 1 cut(s) 47
BseXI GCAGC 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 146
Bsp1720I GCTNAGC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 24
Bst2UI CCWGG 2 cut(s) 26, 39
Bst6I CTCTTC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 2 cut(s) 127, 135
BstNI CCWGG 2 cut(s) 26, 39
BstSCI CCNGG 2 cut(s) 24, 37
BstV1I GCAGC 1 cut(s) 61
BtsCI GGATG 2 cut(s) 127, 135
CviAII CATG 1 cut(s) 49
CviJI RGCY 4 cut(s) 32, 37, 42, 74
CviKI_1 RGCY 4 cut(s) 32, 37, 42, 74
DdeI CTNAG 1 cut(s) 33
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
Eco32I GATATC 1 cut(s) 58
EcoRII CCWGG 2 cut(s) 24, 37
EcoRV GATATC 1 cut(s) 58
FaeI CATG 1 cut(s) 52
FaiI YATR 2 cut(s) 50, 98
FatI CATG 1 cut(s) 48
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 2 cut(s) 122, 134
Fsp4HI GCNGC 1 cut(s) 75
FspBI CTAG 2 cut(s) 78, 92
GluI GCNGC 1 cut(s) 75
Hin1II CATG 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 1 cut(s) 52
LpnPI CCDG 4 cut(s) 11, 24, 38, 51
Lsp1109I GCAGC 1 cut(s) 61
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 78, 92
MboII GAAGA 2 cut(s) 26, 128
MnlI CCTC 1 cut(s) 112
MseI TTAA 2 cut(s) 83, 105
MslI CAYNNNNRTG 1 cut(s) 140
MspR9I CCNGG 2 cut(s) 26, 39
MvaI CCWGG 2 cut(s) 26, 39
NlaIII CATG 1 cut(s) 52
PflMI CCANNNNNTGG 1 cut(s) 146
PkrI GCNGC 1 cut(s) 76
Psp6I CCWGG 2 cut(s) 24, 37
PspGI CCWGG 2 cut(s) 24, 37
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 2 cut(s) 83, 105
SatI GCNGC 1 cut(s) 75
ScrFI CCNGG 2 cut(s) 26, 39
SetI ASST 1 cut(s) 83
SfaNI GCATC 1 cut(s) 97
SgeI CNNG 9 cut(s) 23, 37, 38, 50, 51, 61, 74, 90, 104
SmiMI CAYNNNNRTG 1 cut(s) 140
SspMI CTAG 2 cut(s) 78, 92
StyD4I CCNGG 2 cut(s) 24, 37
Tru1I TTAA 2 cut(s) 83, 105
Tru9I TTAA 2 cut(s) 83, 105
TseI GCWGC 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 65
Van91I CCANNNNNTGG 1 cut(s) 146
XspI CTAG 2 cut(s) 78, 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.