MD02G1051000.v1.1

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0018025
Physical Location & Seq
Reverse (-)
4209994 .. 4211207
1214 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1051000.v1.1.491

Sequence Viewer

Length: 315 bp
ATGGGTTGGGAATTCTATCAATCACTCAACTTAGGATCAATCATTGTCCGTTTGTGTTCTGGTTTTGCAGATACGTTAAAAGGCTCGTTTTATGCAAATCCAATATTGGATACCCCTACAACAGATGAATCTCTAATTCAAAGGTATCCCTCATACTGTGGTTCAAATATATGGCCCGATAGTGAATTGCCAGAACTAGAAGTCGCCTTCAAAGCTCTTGGAAAGGTGATCCTTGGAGTTGGGCTTATGGTCGCATATCACTGTGACAGATACGGTATGGTCTTTCTTGTTAAGGTTTACACTAAGAGAGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

105

Amino Acids

11.65

Weight (kDa)

5.69

Isoelectric Point (pI)

33.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 43, 223
AcsI RAATTY 1 cut(s) 11
AgsI TTSAA 3 cut(s) 140, 165, 211
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 2 cut(s) 43, 223
AoxI GGCC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 238
BciVI GTATCC 2 cut(s) 103, 156
BfaI CTAG 1 cut(s) 197
BfuI GTATCC 2 cut(s) 103, 156
BmgT120I GGNCC 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 232
BseDI CCNNGG 1 cut(s) 232
BshFI GGCC 1 cut(s) 175
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 2 cut(s) 35, 228
BspANI GGCC 1 cut(s) 175
BspPI GGATC 2 cut(s) 43, 223
BssECI CCNNGG 1 cut(s) 232
BssMI GATC 2 cut(s) 35, 228
BssT1I CCWWGG 1 cut(s) 232
Bst4CI ACNGT 3 cut(s) 158, 263, 275
BstDEI CTNAG 2 cut(s) 31, 303
BstKTI GATC 2 cut(s) 38, 231
BstMBI GATC 2 cut(s) 35, 228
BstMWI GCNNNNNNNGC 1 cut(s) 212
BsuI GTATCC 2 cut(s) 103, 156
BsuRI GGCC 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 259
Cfr13I GGNCC 1 cut(s) 174
CviJI RGCY 4 cut(s) 84, 175, 215, 244
CviKI_1 RGCY 4 cut(s) 84, 175, 215, 244
DdeI CTNAG 2 cut(s) 31, 303
DpnI GATC 2 cut(s) 37, 230
DpnII GATC 2 cut(s) 35, 228
Eco130I CCWWGG 1 cut(s) 232
EcoRI GAATTC 1 cut(s) 11
EcoT14I CCWWGG 1 cut(s) 232
ErhI CCWWGG 1 cut(s) 232
FaiI YATR 8 cut(s) 93, 154, 170, 172, 248, 256, 278, 313
FspBI CTAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 175
HinfI GANTC 1 cut(s) 128
HphI GGTGA 1 cut(s) 238
Hpy166II GTNNAC 1 cut(s) 298
Hpy8I GTNNAC 1 cut(s) 298
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 3 cut(s) 158, 263, 275
HpyCH4IV ACGT 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 68, 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 31, 303
HpySE526I ACGT 1 cut(s) 74
Kzo9I GATC 2 cut(s) 35, 228
LpnPI CCDG 2 cut(s) 45, 204
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 263
MalI GATC 2 cut(s) 37, 230
MboI GATC 2 cut(s) 35, 228
MluCI AATT 3 cut(s) 11, 135, 185
MnlI CCTC 1 cut(s) 160
MseI TTAA 2 cut(s) 77, 291
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 2 cut(s) 35, 228
NmuCI GTSAC 1 cut(s) 263
PfeI GAWTC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 174
SaqAI TTAA 2 cut(s) 77, 291
Sau3AI GATC 2 cut(s) 35, 228
Sau96I GGNCC 1 cut(s) 174
SetI ASST 5 cut(s) 77, 146, 217, 228, 297
SgeI CNNG 8 cut(s) 72, 97, 188, 203, 209, 230, 245, 299
Sse9I AATT 3 cut(s) 11, 135, 185
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 197
StyI CCWWGG 1 cut(s) 232
TaaI ACNGT 3 cut(s) 158, 263, 275
TaiI ACGT 1 cut(s) 77
TasI AATT 3 cut(s) 11, 135, 185
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 2 cut(s) 77, 291
Tru9I TTAA 2 cut(s) 77, 291
TscAI CASTG 1 cut(s) 266
TseFI GTSAC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 263
TspDTI ATGAA 1 cut(s) 141
TspGWI ACGGA 1 cut(s) 38
TspRI CASTG 1 cut(s) 266
XapI RAATTY 1 cut(s) 11
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.