MD02G1195500.v1.1

ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum. Recognizes and selectively binds the transmembrane domain of TA proteins in the cytosol. This complex then targets to the endoplasmic reticulum by membrane-bound receptors, where the tail- anchored protein is released for insertion. This process is regulated by ATP binding and hydrolysis. ATP binding drives the homodimer towards the closed dimer state, facilitating recognition of newly synthesized TA membrane proteins. ATP hydrolysis is required for insertion. Subsequently, the homodimer reverts towards the open dimer state, lowering its affinity for the membrane-bound receptor, and returning it to the cytosol to initiate a new round of targeting

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
18720183 .. 18724007
3825 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1195500.v1.1.491

Sequence Viewer

Length: 1080 bp
ATGGCGGCAGAGTCTGATTTACCAGAGGGGACTATACAGAACGTACTGGAACAAGAGAGCCTCAAGTGGGTCTTTGTTGGCGGCAAAGGTGGCGTGGGCAAAACGACATGTAGCTCGATCCTCTCGATCCTTCTCTCCAGAGTCAGATCCTCCGTTTTGATCATCTCCACCGACCCTGCTCACAATCTCAGCGATGCTTTTCAGCAGAAGTTCACCAAGACTCCCACTTTGGTTAATGGGTTCACCAATCTCTATGCCATGGAAGTGGATCCTACCGTTGAGCACGAAGACATGGGTGGAAACGATGGAATGGATAATCTGTTTTCTGATCTAGCAAATGCCATTCCTGGAATTGATGAGGCCATGAGCTTTGCAGAGATGCTGAAACTGGTCCAAACAATGGATTATTCGGTTATAGTATTTGATACTGCACCAACTGGCCATACGCTTCGGCTGTTGCAGTTTCCATCAACCTTGGAGAAAGGTCTGGCAAAAGTGATGTCTTTGAAAAATAAATTTGGCGGTCTAATGACTCAGATGACAAGCCTCTTTGGTGTTGGTGACGAATTTGGAGAGGATGCAATTCTGGGAAAGCTGGAGGGCATGAAAGATGTGATTGAACAAGTCAATAGACAATTTAAAGACCCAGACTTGACGACCTTTGTCTGCGTTTGCATTCCAGAATTCCTCCCTCTCTATGAAACAGAGAGACTAGTGCAGGAACTCACCAAATTTGAGATAGATACACACAATATCATCATTAACCAAGTACTTTATGATGAAGAAGGCACAGAATCTAAACTACTCAAAGCAAGAATGCGAATGCAACAAAAGTACCTTGATCAGTTCTACATGTTGTATGATGACTTTAACATCACCAAGCTGCCATTGCTGCCAGAAGAGGTTACAGGAGTTGATGCTCTAAAAGCGTTTTCGTGTCATTTTCTGACACCATACCAACCTTCCACCAGCAAAGGCACATTGGAAGAGTTAGAGAAAAGGGTGGTCACTCTAAGGCAGCAGTTGAAAGACACCGAAACAGAACTAGAAAGACTGAGGAAAGGAAAACAAAAGGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

360

Amino Acids

40.31

Weight (kDa)

4.82

Isoelectric Point (pI)

39.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ArsA_ATPase PF02374 22 - 313 2e-102 Anion-transporting ATPase
CbiA PF01656 24 - 215 1.2e-08 CobQ/CobB/MinD/ParA nucleotide binding domain
AAA_31 PF13614 28 - 147 7.4e-09 AAA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010938)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 400
AciI CCGC 3 cut(s) 5, 81, 522
AclWI GGATC 5 cut(s) 112, 121, 141, 263, 276
AcoI YGGCCR 1 cut(s) 439
AcsI RAATTY 4 cut(s) 515, 566, 683, 731
AfaI GTAC 3 cut(s) 45, 771, 836
AfiI CCNNNNNNNGG 2 cut(s) 67, 400
AflIII ACRYGT 2 cut(s) 107, 852
AgsI TTSAA 3 cut(s) 508, 620, 1027
AhlI ACTAGT 1 cut(s) 712
AjnI CCWGG 1 cut(s) 346
AluBI AGCT 4 cut(s) 114, 369, 595, 883
AluI AGCT 4 cut(s) 114, 369, 595, 883
Alw21I GWGCWC 1 cut(s) 285
Alw26I GTCTC 1 cut(s) 703
AlwI GGATC 5 cut(s) 112, 121, 141, 263, 276
AlwNI CAGNNNCTG 1 cut(s) 14
AoxI GGCC 2 cut(s) 360, 439
ApeKI GCWGC 3 cut(s) 883, 892, 1018
ApoI RAATTY 4 cut(s) 515, 566, 683, 731
ArsI GACNNNNNNTTYG 4 cut(s) 211, 243, 485, 517
AspS9I GGNCC 1 cut(s) 391
AsuHPI GGTGA 5 cut(s) 205, 235, 572, 718, 868
AvaII GGWCC 1 cut(s) 391
BaeI ACNNNNGTAYC 2 cut(s) 818, 851
BalI TGGCCA 1 cut(s) 441
BamHI GGATCC 1 cut(s) 268
BbsI GAAGAC 1 cut(s) 294
Bbv12I GWGCWC 1 cut(s) 285
BbvI GCAGC 3 cut(s) 870, 879, 1030
BccI CCATC 2 cut(s) 299, 475
BciT130I CCWGG 1 cut(s) 348
BclI TGATCA 2 cut(s) 159, 841
BcoDI GTCTC 1 cut(s) 703
BcuI ACTAGT 1 cut(s) 712
BfaI CTAG 3 cut(s) 332, 713, 1046
BisI GCNGC 5 cut(s) 6, 82, 884, 893, 1019
BlsI GCNGC 5 cut(s) 7, 83, 885, 894, 1020
BmcAI AGTACT 1 cut(s) 771
Bme1390I CCNGG 1 cut(s) 348
Bme18I GGWCC 1 cut(s) 391
BmgT120I GGNCC 1 cut(s) 391
BmiI GGNNCC 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 348
BmsI GCATC 4 cut(s) 184, 369, 568, 907
BoxI GACNNNNGTC 1 cut(s) 662
BpiI GAAGAC 1 cut(s) 294
BpmI CTGGAG 2 cut(s) 121, 617
BpuEI CTTGAG 1 cut(s) 47
BsaJI CCNNGG 2 cut(s) 258, 474
BsaXI ACNNNNNCTCC 2 cut(s) 205, 235
Bsc4I CCNNNNNNNGG 2 cut(s) 67, 400
Bse1I ACTGG 3 cut(s) 51, 393, 442
Bse3DI GCAATG 1 cut(s) 887
BseBI CCWGG 1 cut(s) 348
BseDI CCNNGG 2 cut(s) 258, 474
BseGI GGATG 1 cut(s) 583
BseLI CCNNNNNNNGG 2 cut(s) 67, 400
BseMI GCAATG 1 cut(s) 887
BseMII CTCAG 3 cut(s) 202, 548, 1046
BseNI ACTGG 3 cut(s) 51, 393, 442
BseXI GCAGC 3 cut(s) 870, 879, 1030
BsgI GTGCAG 2 cut(s) 414, 737
BshFI GGCC 2 cut(s) 362, 441
BsiHKAI GWGCWC 1 cut(s) 285
BslFI GGGAC 1 cut(s) 43
BslI CCNNNNNNNGG 2 cut(s) 67, 400
BsmAI GTCTC 1 cut(s) 703
BsmFI GGGAC 1 cut(s) 43
BsmI GAATGC 3 cut(s) 675, 822, 828
BsnI GGCC 2 cut(s) 362, 441
Bsp1286I GDGCHC 1 cut(s) 285
Bsp143I GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
Bsp19I CCATGG 1 cut(s) 258
BspACI CCGC 3 cut(s) 5, 81, 522
BspANI GGCC 2 cut(s) 362, 441
BspCNI CTCAG 3 cut(s) 201, 547, 1047
BspLI GGNNCC 1 cut(s) 270
BspPI GGATC 5 cut(s) 112, 121, 141, 263, 276
BsrDI GCAATG 1 cut(s) 887
BsrI ACTGG 3 cut(s) 51, 393, 442
BssECI CCNNGG 2 cut(s) 258, 474
BssMI GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
BssT1I CCWWGG 2 cut(s) 258, 474
Bst2UI CCWGG 1 cut(s) 348
Bst4CI ACNGT 1 cut(s) 277
Bst6I CTCTTC 2 cut(s) 894, 981
BstDEI CTNAG 4 cut(s) 188, 534, 1013, 1055
BstDSI CCRYGG 1 cut(s) 258
BstF5I GGATG 1 cut(s) 583
BstKTI GATC 7 cut(s) 120, 129, 149, 162, 271, 331, 844
BstMAI GTCTC 1 cut(s) 703
BstMBI GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
BstMWI GCNNNNNNNGC 4 cut(s) 90, 889, 892, 926
BstNI CCWGG 1 cut(s) 348
BstNSI RCATGY 2 cut(s) 111, 856
BstPAI GACNNNNGTC 1 cut(s) 662
BstSCI CCNGG 1 cut(s) 346
BstV1I GCAGC 3 cut(s) 870, 879, 1030
BstV2I GAAGAC 1 cut(s) 294
BstX2I RGATCY 2 cut(s) 146, 268
BstXI CCANNNNNNTGG 1 cut(s) 265
BstYI RGATCY 2 cut(s) 146, 268
BsuRI GGCC 2 cut(s) 362, 441
BtgI CCRYGG 1 cut(s) 258
BtgZI GCGATG 1 cut(s) 207
BtsCI GGATG 1 cut(s) 583
CaiI CAGNNNCTG 1 cut(s) 14
Cfr13I GGNCC 1 cut(s) 391
Csp6I GTAC 3 cut(s) 44, 770, 835
CviAII CATG 6 cut(s) 108, 259, 292, 364, 604, 853
CviJI RGCY 9 cut(s) 60, 114, 362, 369, 441, 454, 546, 595, 883
CviKI_1 RGCY 9 cut(s) 60, 114, 362, 369, 441, 454, 546, 595, 883
CviQI GTAC 3 cut(s) 44, 770, 835
DdeI CTNAG 4 cut(s) 188, 534, 1013, 1055
DpnI GATC 7 cut(s) 119, 128, 148, 161, 270, 330, 843
DpnII GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
DraI TTTAAA 1 cut(s) 640
EaeI YGGCCR 1 cut(s) 439
Eam1104I CTCTTC 2 cut(s) 894, 981
EarI CTCTTC 2 cut(s) 894, 981
Eco130I CCWWGG 2 cut(s) 258, 474
Eco47I GGWCC 1 cut(s) 391
EcoRI GAATTC 1 cut(s) 683
EcoRII CCWGG 1 cut(s) 346
EcoT14I CCWWGG 2 cut(s) 258, 474
ErhI CCWWGG 2 cut(s) 258, 474
FaeI CATG 6 cut(s) 111, 262, 295, 367, 607, 856
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FaqI GGGAC 1 cut(s) 43
FatI CATG 6 cut(s) 107, 258, 291, 363, 603, 852
FbaI TGATCA 2 cut(s) 159, 841
Fnu4HI GCNGC 5 cut(s) 6, 82, 884, 893, 1019
FokI GGATG 1 cut(s) 590
Fsp4HI GCNGC 5 cut(s) 6, 82, 884, 893, 1019
FspBI CTAG 3 cut(s) 332, 713, 1046
GluI GCNGC 5 cut(s) 6, 82, 884, 893, 1019
GsuI CTGGAG 2 cut(s) 121, 617
HaeIII GGCC 2 cut(s) 362, 441
Hin1II CATG 6 cut(s) 111, 262, 295, 367, 607, 856
HinfI GANTC 5 cut(s) 11, 141, 220, 532, 794
HphI GGTGA 5 cut(s) 205, 235, 572, 718, 868
Hpy166II GTNNAC 2 cut(s) 213, 243
Hpy188I TCNGA 5 cut(s) 16, 146, 328, 537, 948
Hpy188III TCNNGA 3 cut(s) 124, 138, 680
Hpy8I GTNNAC 2 cut(s) 213, 243
HpyAV CCTTC 3 cut(s) 140, 779, 972
HpyCH4III ACNGT 1 cut(s) 277
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 7 cut(s) 374, 431, 460, 581, 675, 718, 826
HpyF10VI GCNNNNNNNGC 4 cut(s) 90, 889, 892, 926
HpyF3I CTNAG 4 cut(s) 188, 534, 1013, 1055
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 6 cut(s) 111, 262, 295, 367, 607, 856
Ksp22I TGATCA 2 cut(s) 159, 841
Kzo9I GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
Lsp1109I GCAGC 3 cut(s) 870, 879, 1030
LweI GCATC 4 cut(s) 184, 369, 568, 907
MaeI CTAG 3 cut(s) 332, 713, 1046
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 3 cut(s) 560, 904, 1006
MalI GATC 7 cut(s) 119, 128, 148, 161, 270, 330, 843
MboI GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
MboII GAAGA 4 cut(s) 299, 794, 911, 998
MflI RGATCY 2 cut(s) 146, 268
MhlI GDGCHC 1 cut(s) 285
MlsI TGGCCA 1 cut(s) 441
MluCI AATT 7 cut(s) 351, 515, 566, 582, 635, 683, 731
MluNI TGGCCA 1 cut(s) 441
MlyI GAGTC 4 cut(s) 20, 150, 214, 526
Mox20I TGGCCA 1 cut(s) 441
MscI TGGCCA 1 cut(s) 441
MseI TTAA 4 cut(s) 234, 639, 762, 870
MslI CAYNNNNRTG 1 cut(s) 263
Msp20I TGGCCA 1 cut(s) 441
MspR9I CCNGG 1 cut(s) 348
Mva1269I GAATGC 3 cut(s) 675, 822, 828
MvaI CCWGG 1 cut(s) 348
MwoI GCNNNNNNNGC 4 cut(s) 90, 889, 892, 926
NcoI CCATGG 1 cut(s) 258
NdeII GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
NlaIII CATG 6 cut(s) 111, 262, 295, 367, 607, 856
NlaIV GGNNCC 1 cut(s) 270
NmuCI GTSAC 2 cut(s) 560, 1006
NspI RCATGY 2 cut(s) 111, 856
PciI ACATGT 2 cut(s) 107, 852
PcsI WCGNNNNNNNCGW 1 cut(s) 122
PctI GAATGC 3 cut(s) 675, 822, 828
PfeI GAWTC 1 cut(s) 794
PflMI CCANNNNNTGG 1 cut(s) 400
PfoI TCCNGGA 1 cut(s) 346
PkrI GCNGC 5 cut(s) 7, 83, 885, 894, 1020
PleI GAGTC 4 cut(s) 19, 149, 214, 526
PpsI GAGTC 4 cut(s) 19, 149, 214, 526
PscI ACATGT 2 cut(s) 107, 852
PshAI GACNNNNGTC 1 cut(s) 662
Psp6I CCWGG 1 cut(s) 346
PspGI CCWGG 1 cut(s) 346
PspN4I GGNNCC 1 cut(s) 270
PspPI GGNCC 1 cut(s) 391
PstNI CAGNNNCTG 1 cut(s) 14
PsuI RGATCY 2 cut(s) 146, 268
RsaI GTAC 3 cut(s) 45, 771, 836
RsaNI GTAC 3 cut(s) 44, 770, 835
RseI CAYNNNNRTG 1 cut(s) 263
SaqAI TTAA 4 cut(s) 234, 639, 762, 870
SatI GCNGC 5 cut(s) 6, 82, 884, 893, 1019
Sau3AI GATC 7 cut(s) 117, 126, 146, 159, 268, 328, 841
Sau96I GGNCC 1 cut(s) 391
ScaI AGTACT 1 cut(s) 771
SchI GAGTC 4 cut(s) 20, 150, 214, 526
ScrFI CCNGG 1 cut(s) 348
SduI GDGCHC 1 cut(s) 285
SfaNI GCATC 4 cut(s) 184, 369, 568, 907
SinI GGWCC 1 cut(s) 391
SmiMI CAYNNNNRTG 1 cut(s) 263
SmlI CTYRAG 1 cut(s) 62
SmoI CTYRAG 1 cut(s) 62
SpeI ACTAGT 1 cut(s) 712
Sse9I AATT 7 cut(s) 351, 515, 566, 582, 635, 683, 731
SsiI CCGC 3 cut(s) 5, 81, 522
SspMI CTAG 3 cut(s) 332, 713, 1046
StyD4I CCNGG 1 cut(s) 346
StyI CCWWGG 2 cut(s) 258, 474
TaaI ACNGT 1 cut(s) 277
TaiI ACGT 1 cut(s) 45
TaqI TCGA 2 cut(s) 116, 125
TasI AATT 7 cut(s) 351, 515, 566, 582, 635, 683, 731
TatI WGTACW 1 cut(s) 769
TauI GCSGC 2 cut(s) 8, 84
TfiI GAWTC 1 cut(s) 794
Tru1I TTAA 4 cut(s) 234, 639, 762, 870
Tru9I TTAA 4 cut(s) 234, 639, 762, 870
TseFI GTSAC 2 cut(s) 560, 1006
TseI GCWGC 3 cut(s) 883, 892, 1018
Tsp45I GTSAC 2 cut(s) 560, 1006
TspDTI ATGAA 3 cut(s) 620, 714, 795
TspGWI ACGGA 1 cut(s) 142
Van91I CCANNNNNTGG 1 cut(s) 400
VpaK11BI GGWCC 1 cut(s) 391
XapI RAATTY 4 cut(s) 515, 566, 683, 731
XceI RCATGY 2 cut(s) 111, 856
XspI CTAG 3 cut(s) 332, 713, 1046
ZrmI AGTACT 1 cut(s) 771
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.