Rroxscaffold_4G00303370

ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum. Recognizes and selectively binds the transmembrane domain of TA proteins in the cytosol. This complex then targets to the endoplasmic reticulum by membrane-bound receptors, where the tail- anchored protein is released for insertion. This process is regulated by ATP binding and hydrolysis. ATP binding drives the homodimer towards the closed dimer state, facilitating recognition of newly synthesized TA membrane proteins. ATP hydrolysis is required for insertion. Subsequently, the homodimer reverts towards the open dimer state, lowering its affinity for the membrane-bound receptor, and returning it to the cytosol to initiate a new round of targeting

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
23807175 .. 23811468
4294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00303370.1

Sequence Viewer

Length: 1131 bp
ATGGCAGCCTCTGATTTACCAGAGGGGACTCTTCAGAACGTACTGGAGCAAGAGACCCTCAAGTGGGTCTTCGTTGGCGGCAAAGGTGGGGTTGGCAAAACGACGTGTAGCTCAATCCTCTCGATCCTTCTCGCCAGTGTTAGATCCTCTGTTTTGATTATCTCCACTGACCCTGCTCACAATCTCAGCGATGCTTTTCAGCAAAAGTTCACCAAGACTCCAACTTTGGTTAATGGGTTCCCCAATCTATATGCCATGGAAGTGGATCCTACGGTTGAGCATGAAGACATTGGCGGAGAGAATGGAATGGATAGTTTGGTTTCGGAGCTAGCAAATGCTATTCCAGGGATTGATGAGGCCATGAGCTTTGCAGAGATGCTAAAATTGGTTCAAACAATGGATTATTCTGTTATTGTATTTGACACTGCACCGACTGGTCATACGCTTCGGTTGTTGCAGTTTCCATCAACATTGGAGAAAGGTCTCGCAAAAGTGATGTCTTTGAAAAATAAATTTGGCGGTTTAATGAGTCAGCTATTTGATGCTGTCTTAAGGCAGATGACACGCCTCTTTGGTGTTGATGATGAATTTGGAGAGGATGCGATTTTAGGAAAGCTTGAGGGCATGAAAGAAGTAATAGAGCAAGTTAATAAGCAATTCAAAGACCCAGTATTTGTTGATGCACTCATATCTCACTATTCGCAGGACTTGACAACGTTCGTTTGTGTTTGCATTCCTGAATTCTTGTCTCTCTATGAAACAGAGAGACTGGTGCAGGAACTCACCAAATTTGAGATAGATACGCACAATATTATTATTAACCAAGTACTTTATGATGAAGAAGACTCGCAGTCCAAATTACTTCAAGCAAGAATGCGAATGCAACAAAAGTACCTTGACCAGTTCTACATGTTATATGATGATTTTAACATAACCAAGCTCCCATTGCTGCCTGAAGAGGTTACTGGAGTGGAAGCTCTGAAAGCGTTTTCATGCCATTTTCTGACACCGTATCAACCTTCCACCAGCACGGTGGAATCGTTAGAGCAAAGGGTGTCCACGCTAAGGCAGCAGTTGAAAGACACTGAAGCAGAGCTAGAAAGACTAAGAAAGGGAAAGCAAAAGGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

376

Amino Acids

42.18

Weight (kDa)

4.75

Isoelectric Point (pI)

47.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ArsA_ATPase PF02374 21 - 332 1.2e-95 Anion-transporting ATPase
CbiA PF01656 23 - 221 8.9e-09 CobQ/CobB/MinD/ParA nucleotide binding domain
AAA_31 PF13614 27 - 146 2.7e-09 AAA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010938)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 78, 294, 519
AclI AACGTT 1 cut(s) 716
AclWI GGATC 4 cut(s) 118, 138, 260, 273
AcsI RAATTY 4 cut(s) 512, 587, 740, 788
AcuI CTGAAG 3 cut(s) 17, 975, 1107
AfaI GTAC 3 cut(s) 42, 828, 893
AfiI CCNNNNNNNGG 3 cut(s) 63, 64, 1065
AflII CTTAAG 1 cut(s) 550
AflIII ACRYGT 2 cut(s) 104, 909
AgsI TTSAA 5 cut(s) 392, 505, 661, 866, 1078
AhdI GACNNNNNGTC 1 cut(s) 850
AjiI CACGTC 1 cut(s) 105
AjnI CCWGG 1 cut(s) 343
AluBI AGCT 8 cut(s) 111, 328, 366, 535, 616, 940, 977, 1096
AluI AGCT 8 cut(s) 111, 328, 366, 535, 616, 940, 977, 1096
Alw26I GTCTC 4 cut(s) 47, 488, 753, 760
AlwI GGATC 4 cut(s) 118, 138, 260, 273
AlwNI CAGNNNCTG 1 cut(s) 11
AoxI GGCC 2 cut(s) 357, 1125
ApeKI GCWGC 3 cut(s) 5, 949, 1069
ApoI RAATTY 4 cut(s) 512, 587, 740, 788
ArsI GACNNNNNNTTYG 6 cut(s) 208, 240, 482, 514, 656, 688
AsuHPI GGTGA 2 cut(s) 202, 775
AsuNHI GCTAGC 1 cut(s) 328
BaeI ACNNNNGTAYC 2 cut(s) 875, 908
BamHI GGATCC 1 cut(s) 265
BbsI GAAGAC 3 cut(s) 61, 291, 849
BbvI GCAGC 3 cut(s) 17, 936, 1081
BccI CCATC 1 cut(s) 472
BciT130I CCWGG 1 cut(s) 345
BcoDI GTCTC 4 cut(s) 47, 488, 753, 760
BfaI CTAG 2 cut(s) 329, 1097
BfrI CTTAAG 1 cut(s) 550
BisI GCNGC 4 cut(s) 6, 79, 950, 1070
BlsI GCNGC 4 cut(s) 7, 80, 951, 1071
BmcAI AGTACT 1 cut(s) 828
Bme1390I CCNGG 1 cut(s) 345
BmeRI GACNNNNNGTC 1 cut(s) 850
BmgBI CACGTC 1 cut(s) 105
BmiI GGNNCC 2 cut(s) 239, 267
BmrFI CCNGG 1 cut(s) 345
BmrI ACTGGG 1 cut(s) 662
BmsI GCATC 5 cut(s) 181, 366, 532, 589, 670
BmtI GCTAGC 1 cut(s) 332
BmuI ACTGGG 1 cut(s) 662
BpiI GAAGAC 3 cut(s) 61, 291, 849
BpmI CTGGAG 2 cut(s) 65, 987
Bpu10I CCTNAGC 1 cut(s) 1064
BpuEI CTTGAG 2 cut(s) 44, 638
BsaI GGTCTC 2 cut(s) 47, 488
BsaJI CCNNGG 2 cut(s) 255, 344
BsaXI ACNNNNNCTCC 2 cut(s) 202, 232
Bsc4I CCNNNNNNNGG 3 cut(s) 63, 64, 1065
Bse1I ACTGG 7 cut(s) 48, 135, 439, 668, 774, 901, 970
Bse3DI GCAATG 1 cut(s) 944
BseBI CCWGG 1 cut(s) 345
BseDI CCNNGG 2 cut(s) 255, 344
BseGI GGATG 1 cut(s) 604
BseLI CCNNNNNNNGG 3 cut(s) 63, 64, 1065
BseMI GCAATG 1 cut(s) 944
BseMII CTCAG 1 cut(s) 199
BseNI ACTGG 7 cut(s) 48, 135, 439, 668, 774, 901, 970
BseXI GCAGC 3 cut(s) 17, 936, 1081
BsgI GTGCAG 2 cut(s) 411, 794
BshFI GGCC 2 cut(s) 359, 1127
BslFI GGGAC 1 cut(s) 40
BslI CCNNNNNNNGG 3 cut(s) 63, 64, 1065
BsmAI GTCTC 4 cut(s) 47, 488, 753, 760
BsmFI GGGAC 1 cut(s) 40
BsmI GAATGC 3 cut(s) 732, 879, 885
BsnI GGCC 2 cut(s) 359, 1127
Bso31I GGTCTC 2 cut(s) 47, 488
Bsp143I GATC 3 cut(s) 123, 143, 265
Bsp19I CCATGG 1 cut(s) 255
BspACI CCGC 3 cut(s) 78, 294, 519
BspANI GGCC 2 cut(s) 359, 1127
BspCNI CTCAG 1 cut(s) 198
BspLI GGNNCC 2 cut(s) 239, 267
BspOI GCTAGC 1 cut(s) 332
BspPI GGATC 4 cut(s) 118, 138, 260, 273
BspTI CTTAAG 1 cut(s) 550
BspTNI GGTCTC 2 cut(s) 47, 488
BsrDI GCAATG 1 cut(s) 944
BsrI ACTGG 7 cut(s) 48, 135, 439, 668, 774, 901, 970
BssECI CCNNGG 2 cut(s) 255, 344
BssMI GATC 3 cut(s) 123, 143, 265
BssT1I CCWWGG 1 cut(s) 255
Bst2UI CCWGG 1 cut(s) 345
Bst4CI ACNGT 3 cut(s) 274, 1011, 1033
Bst6I CTCTTC 2 cut(s) 36, 951
BstAFI CTTAAG 1 cut(s) 550
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 3 cut(s) 185, 1064, 1106
BstDSI CCRYGG 1 cut(s) 255
BstF5I GGATG 1 cut(s) 604
BstKTI GATC 3 cut(s) 126, 146, 268
BstMAI GTCTC 4 cut(s) 47, 488, 753, 760
BstMBI GATC 3 cut(s) 123, 143, 265
BstMWI GCNNNNNNNGC 3 cut(s) 946, 983, 1069
BstNI CCWGG 1 cut(s) 345
BstNSI RCATGY 1 cut(s) 913
BstSCI CCNGG 1 cut(s) 343
BstV1I GCAGC 3 cut(s) 17, 936, 1081
BstV2I GAAGAC 3 cut(s) 61, 291, 849
BstX2I RGATCY 2 cut(s) 143, 265
BstXI CCANNNNNNTGG 2 cut(s) 262, 1033
BstYI RGATCY 2 cut(s) 143, 265
BsuRI GGCC 2 cut(s) 359, 1127
BtgI CCRYGG 1 cut(s) 255
BtgZI GCGATG 1 cut(s) 204
BtrI CACGTC 1 cut(s) 105
BtsCI GGATG 1 cut(s) 604
BtsI GCAGTG 1 cut(s) 423
BtsIMutI CAGTG 4 cut(s) 142, 165, 423, 1083
Cac8I GCNNGC 1 cut(s) 330
CaiI CAGNNNCTG 1 cut(s) 11
Csp6I GTAC 3 cut(s) 41, 827, 892
CviAII CATG 6 cut(s) 256, 281, 361, 625, 910, 993
CviQI GTAC 3 cut(s) 41, 827, 892
DdeI CTNAG 3 cut(s) 185, 1064, 1106
DpnI GATC 3 cut(s) 125, 145, 267
DpnII GATC 3 cut(s) 123, 143, 265
DriI GACNNNNNGTC 1 cut(s) 850
Eam1104I CTCTTC 2 cut(s) 36, 951
Eam1105I GACNNNNNGTC 1 cut(s) 850
EarI CTCTTC 2 cut(s) 36, 951
EciI GGCGGA 1 cut(s) 309
Eco130I CCWWGG 1 cut(s) 255
Eco147I AGGCCT 1 cut(s) 1127
Eco31I GGTCTC 2 cut(s) 47, 488
Eco57I CTGAAG 3 cut(s) 17, 975, 1107
EcoRI GAATTC 1 cut(s) 740
EcoRII CCWGG 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 255
ErhI CCWWGG 1 cut(s) 255
FaeI CATG 6 cut(s) 259, 284, 364, 628, 913, 996
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FaqI GGGAC 1 cut(s) 40
FatI CATG 6 cut(s) 255, 280, 360, 624, 909, 992
Fnu4HI GCNGC 4 cut(s) 6, 79, 950, 1070
FokI GGATG 1 cut(s) 611
Fsp4HI GCNGC 4 cut(s) 6, 79, 950, 1070
FspBI CTAG 2 cut(s) 329, 1097
GluI GCNGC 4 cut(s) 6, 79, 950, 1070
GsuI CTGGAG 2 cut(s) 65, 987
HaeIII GGCC 2 cut(s) 359, 1127
Hin1II CATG 6 cut(s) 259, 284, 364, 628, 913, 996
HindIII AAGCTT 1 cut(s) 614
HinfI GANTC 5 cut(s) 28, 217, 529, 845, 1037
HphI GGTGA 2 cut(s) 202, 775
Hpy166II GTNNAC 2 cut(s) 210, 1059
Hpy188I TCNGA 5 cut(s) 13, 36, 325, 981, 1005
Hpy188III TCNNGA 2 cut(s) 121, 737
Hpy8I GTNNAC 2 cut(s) 210, 1059
Hpy99I CGWCG 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 137, 1029
HpyCH4III ACNGT 3 cut(s) 274, 1011, 1033
HpyCH4IV ACGT 3 cut(s) 39, 104, 716
HpyCH4V TGCA 7 cut(s) 371, 428, 457, 683, 732, 775, 883
HpyF10VI GCNNNNNNNGC 3 cut(s) 946, 983, 1069
HpyF3I CTNAG 3 cut(s) 185, 1064, 1106
HpySE526I ACGT 3 cut(s) 39, 104, 716
Hsp92II CATG 6 cut(s) 259, 284, 364, 628, 913, 996
Kzo9I GATC 3 cut(s) 123, 143, 265
LmnI GCTCC 3 cut(s) 46, 325, 945
Lsp1109I GCAGC 3 cut(s) 17, 936, 1081
LweI GCATC 5 cut(s) 181, 366, 532, 589, 670
MaeI CTAG 2 cut(s) 329, 1097
MaeII ACGT 3 cut(s) 39, 104, 716
MaeIII GTNAC 1 cut(s) 961
MalI GATC 3 cut(s) 125, 145, 267
MboI GATC 3 cut(s) 123, 143, 265
MboII GAAGA 6 cut(s) 23, 61, 296, 851, 854, 968
MflI RGATCY 2 cut(s) 143, 265
MluCI AATT 7 cut(s) 383, 512, 587, 656, 740, 788, 857
MlyI GAGTC 4 cut(s) 22, 211, 538, 839
MmeI TCCRAC 1 cut(s) 245
MseI TTAA 6 cut(s) 231, 524, 551, 648, 819, 927
MslI CAYNNNNRTG 1 cut(s) 260
MspCI CTTAAG 1 cut(s) 550
MspR9I CCNGG 1 cut(s) 345
Mva1269I GAATGC 3 cut(s) 732, 879, 885
MvaI CCWGG 1 cut(s) 345
MwoI GCNNNNNNNGC 3 cut(s) 946, 983, 1069
NcoI CCATGG 1 cut(s) 255
NdeII GATC 3 cut(s) 123, 143, 265
NheI GCTAGC 1 cut(s) 328
NlaIII CATG 6 cut(s) 259, 284, 364, 628, 913, 996
NlaIV GGNNCC 2 cut(s) 239, 267
NspI RCATGY 1 cut(s) 913
PceI AGGCCT 1 cut(s) 1127
PciI ACATGT 1 cut(s) 909
PcsI WCGNNNNNNNCGW 1 cut(s) 1037
PctI GAATGC 3 cut(s) 732, 879, 885
PfeI GAWTC 1 cut(s) 1037
PkrI GCNGC 4 cut(s) 7, 80, 951, 1071
PleI GAGTC 4 cut(s) 22, 211, 537, 839
PpsI GAGTC 4 cut(s) 22, 211, 537, 839
PscI ACATGT 1 cut(s) 909
Psp1406I AACGTT 1 cut(s) 716
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspN4I GGNNCC 2 cut(s) 239, 267
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 143, 265
RsaI GTAC 3 cut(s) 42, 828, 893
RsaNI GTAC 3 cut(s) 41, 827, 892
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 6 cut(s) 231, 524, 551, 648, 819, 927
SatI GCNGC 4 cut(s) 6, 79, 950, 1070
Sau3AI GATC 3 cut(s) 123, 143, 265
ScaI AGTACT 1 cut(s) 828
SchI GAGTC 4 cut(s) 22, 211, 538, 839
ScrFI CCNGG 1 cut(s) 345
SfaNI GCATC 5 cut(s) 181, 366, 532, 589, 670
SmiMI CAYNNNNRTG 1 cut(s) 260
SmlI CTYRAG 3 cut(s) 59, 550, 617
SmoI CTYRAG 3 cut(s) 59, 550, 617
Sse9I AATT 7 cut(s) 383, 512, 587, 656, 740, 788, 857
SseBI AGGCCT 1 cut(s) 1127
SsiI CCGC 3 cut(s) 78, 294, 519
SspI AATATT 1 cut(s) 811
SspMI CTAG 2 cut(s) 329, 1097
StuI AGGCCT 1 cut(s) 1127
StyD4I CCNGG 1 cut(s) 343
StyI CCWWGG 1 cut(s) 255
TaaI ACNGT 3 cut(s) 274, 1011, 1033
TaiI ACGT 3 cut(s) 42, 107, 719
TaqI TCGA 1 cut(s) 122
TasI AATT 7 cut(s) 383, 512, 587, 656, 740, 788, 857
TatI WGTACW 1 cut(s) 826
TauI GCSGC 1 cut(s) 81
TfiI GAWTC 1 cut(s) 1037
Tru1I TTAA 6 cut(s) 231, 524, 551, 648, 819, 927
Tru9I TTAA 6 cut(s) 231, 524, 551, 648, 819, 927
TscAI CASTG 4 cut(s) 142, 172, 430, 1090
TseI GCWGC 3 cut(s) 5, 949, 1069
TspDTI ATGAA 6 cut(s) 297, 600, 641, 771, 852, 981
TspRI CASTG 4 cut(s) 142, 172, 430, 1090
Vha464I CTTAAG 1 cut(s) 550
XapI RAATTY 4 cut(s) 512, 587, 740, 788
XceI RCATGY 1 cut(s) 913
XcmI CCANNNNNNNNNTGG 1 cut(s) 1030
XspI CTAG 2 cut(s) 329, 1097
ZrmI AGTACT 1 cut(s) 828
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.