Rh1BG207500

ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum. Recognizes and selectively binds the transmembrane domain of TA proteins in the cytosol. This complex then targets to the endoplasmic reticulum by membrane-bound receptors, where the tail- anchored protein is released for insertion. This process is regulated by ATP binding and hydrolysis. ATP binding drives the homodimer towards the closed dimer state, facilitating recognition of newly synthesized TA membrane proteins. ATP hydrolysis is required for insertion. Subsequently, the homodimer reverts towards the open dimer state, lowering its affinity for the membrane-bound receptor, and returning it to the cytosol to initiate a new round of targeting

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
32547802 .. 32553065
5264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG207500.1

Sequence Viewer

Length: 936 bp
ATGGCAGCCTCTGATTTACCAGAGGGGACTCTTCAGAACGTACTGGAGCAAGAGACCCTCAAGTGGGTCTTCGTTGGCGGCAAAGGTGGGGTTGGCAAAACGACGTGTAGCTCAATCCTCTCGATCCTTCTCGCCAGTGTTAGATCCTCTGTTTTGATTATCTCCACCGACCCTGCTCACAATCTCAGCGATGCTTTTCAGCAAAAGTTCACCAAGACTCCAACTTTGGTTAATGGGTTCCCCAATCTGTATGCCATGGAAGTGGATCCTACTGTTGAGCATGAAGACATTGGCGGAGAGAATGGAATGGATAGTTTGGTTTCGGAGCTAGCAAATGCTATTCCAGGGATTGATGAGGCCATGAGCTTTGCAGAGATGTTAAAATTGGTTCAAACAATGGATTATTCTGTTATTGTATTTGACACTGCACCGACTGGTCATACGCTTCGGCTATTGCAGTTTCCATCGACATTGGAGAAAGGTCTTGCAAAAGTGATGTCTTTGAAAAATAAATTTGGCGGTTTAATGAGTCAGATGACCCGCCTCTTTGGTGTTGATGATGAATTTGGAGAGGATGCGATTTTAGGAAAGCTTGAGGGCATGAAAGAAGTAATAGAGCAAGTTAATAAGCAATTCAAAGACCCGGACTTGACAACATTCGTTTGTGTTTGCATTCCTGAATTCCTGTCTCTCTATGAAACAGAGAGACTGGTGCAGGAACTCGCCAAATTTGAGATAGATACGCACAATATTATCATTAACCAAGTACTTTATGATGAAGAAGACTCGCAGTCCAAATTACTTAAAGCAAGAATGCGAATGCAACAAAAGTACCTTGACCAGTTCTACATGTTGTACGATGATTTTAACATAACCAAGCTCCCATTGCTGCCTGAAGAGGTAAACCATAGAGTGCAATCTTTGTTGAGCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

311

Amino Acids

34.81

Weight (kDa)

4.63

Isoelectric Point (pI)

44.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ArsA_ATPase PF02374 21 - 302 4.2e-100 Anion-transporting ATPase
CbiA PF01656 23 - 243 2.4e-09 CobQ/CobB/MinD/ParA nucleotide binding domain
AAA_31 PF13614 27 - 147 1.8e-09 AAA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010938)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 78, 294, 519, 541
AclWI GGATC 4 cut(s) 118, 138, 260, 273
AcsI RAATTY 4 cut(s) 512, 563, 680, 728
AcuI CTGAAG 2 cut(s) 17, 915
AfaI GTAC 4 cut(s) 42, 768, 833, 857
AfiI CCNNNNNNNGG 2 cut(s) 63, 64
AflIII ACRYGT 2 cut(s) 104, 849
AgsI TTSAA 3 cut(s) 392, 505, 637
AhdI GACNNNNNGTC 1 cut(s) 790
AjiI CACGTC 1 cut(s) 105
AjnI CCWGG 1 cut(s) 343
AluBI AGCT 6 cut(s) 111, 328, 366, 592, 880, 930
AluI AGCT 6 cut(s) 111, 328, 366, 592, 880, 930
Alw26I GTCTC 3 cut(s) 47, 693, 700
AlwI GGATC 4 cut(s) 118, 138, 260, 273
AlwNI CAGNNNCTG 1 cut(s) 11
AoxI GGCC 1 cut(s) 357
ApeKI GCWGC 2 cut(s) 5, 889
ApoI RAATTY 4 cut(s) 512, 563, 680, 728
ArsI GACNNNNNNTTYG 4 cut(s) 208, 240, 482, 514
AsuC2I CCSGG 1 cut(s) 644
AsuHPI GGTGA 1 cut(s) 202
AsuNHI GCTAGC 1 cut(s) 328
BaeI ACNNNNGTAYC 2 cut(s) 815, 848
BamHI GGATCC 1 cut(s) 265
BbsI GAAGAC 3 cut(s) 61, 291, 789
BbvI GCAGC 2 cut(s) 17, 876
BccI CCATC 1 cut(s) 472
BciT130I CCWGG 1 cut(s) 345
BcnI CCSGG 1 cut(s) 644
BcoDI GTCTC 3 cut(s) 47, 693, 700
BfaI CTAG 1 cut(s) 329
BisI GCNGC 3 cut(s) 6, 79, 890
BlsI GCNGC 3 cut(s) 7, 80, 891
BmcAI AGTACT 1 cut(s) 768
Bme1390I CCNGG 2 cut(s) 345, 644
BmeRI GACNNNNNGTC 1 cut(s) 790
BmgBI CACGTC 1 cut(s) 105
BmiI GGNNCC 2 cut(s) 239, 267
BmrFI CCNGG 2 cut(s) 345, 644
BmsI GCATC 2 cut(s) 181, 565
BmtI GCTAGC 1 cut(s) 332
BpiI GAAGAC 3 cut(s) 61, 291, 789
BpmI CTGGAG 1 cut(s) 65
BpuEI CTTGAG 2 cut(s) 44, 614
BpuMI CCSGG 1 cut(s) 644
BsaI GGTCTC 1 cut(s) 47
BsaJI CCNNGG 2 cut(s) 255, 344
BsaXI ACNNNNNCTCC 2 cut(s) 202, 232
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 64
Bse1I ACTGG 5 cut(s) 48, 135, 439, 714, 841
Bse3DI GCAATG 1 cut(s) 884
BseBI CCWGG 1 cut(s) 345
BseDI CCNNGG 2 cut(s) 255, 344
BseGI GGATG 1 cut(s) 580
BseLI CCNNNNNNNGG 2 cut(s) 63, 64
BseMI GCAATG 1 cut(s) 884
BseMII CTCAG 1 cut(s) 199
BseNI ACTGG 5 cut(s) 48, 135, 439, 714, 841
BseXI GCAGC 2 cut(s) 17, 876
BsgI GTGCAG 2 cut(s) 411, 734
BshFI GGCC 1 cut(s) 359
BsiSI CCGG 1 cut(s) 644
BslFI GGGAC 1 cut(s) 40
BslI CCNNNNNNNGG 2 cut(s) 63, 64
BsmAI GTCTC 3 cut(s) 47, 693, 700
BsmFI GGGAC 1 cut(s) 40
BsmI GAATGC 3 cut(s) 672, 819, 825
BsnI GGCC 1 cut(s) 359
Bso31I GGTCTC 1 cut(s) 47
Bsp143I GATC 3 cut(s) 123, 143, 265
Bsp19I CCATGG 1 cut(s) 255
BspACI CCGC 4 cut(s) 78, 294, 519, 541
BspANI GGCC 1 cut(s) 359
BspCNI CTCAG 1 cut(s) 198
BspLI GGNNCC 2 cut(s) 239, 267
BspOI GCTAGC 1 cut(s) 332
BspPI GGATC 4 cut(s) 118, 138, 260, 273
BspTNI GGTCTC 1 cut(s) 47
BsrDI GCAATG 1 cut(s) 884
BsrI ACTGG 5 cut(s) 48, 135, 439, 714, 841
BssECI CCNNGG 2 cut(s) 255, 344
BssMI GATC 3 cut(s) 123, 143, 265
BssT1I CCWWGG 1 cut(s) 255
Bst2UI CCWGG 1 cut(s) 345
Bst4CI ACNGT 1 cut(s) 274
Bst6I CTCTTC 2 cut(s) 36, 891
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 1 cut(s) 185
BstDSI CCRYGG 1 cut(s) 255
BstF5I GGATG 1 cut(s) 580
BstKTI GATC 3 cut(s) 126, 146, 268
BstMAI GTCTC 3 cut(s) 47, 693, 700
BstMBI GATC 3 cut(s) 123, 143, 265
BstMWI GCNNNNNNNGC 1 cut(s) 886
BstNI CCWGG 1 cut(s) 345
BstNSI RCATGY 1 cut(s) 853
BstSCI CCNGG 2 cut(s) 343, 642
BstV1I GCAGC 2 cut(s) 17, 876
BstV2I GAAGAC 3 cut(s) 61, 291, 789
BstX2I RGATCY 2 cut(s) 143, 265
BstXI CCANNNNNNTGG 1 cut(s) 262
BstYI RGATCY 2 cut(s) 143, 265
BsuRI GGCC 1 cut(s) 359
BtgI CCRYGG 1 cut(s) 255
BtgZI GCGATG 1 cut(s) 204
BtrI CACGTC 1 cut(s) 105
BtsCI GGATG 1 cut(s) 580
BtsI GCAGTG 1 cut(s) 423
BtsIMutI CAGTG 2 cut(s) 142, 423
Cac8I GCNNGC 1 cut(s) 330
CaiI CAGNNNCTG 1 cut(s) 11
Csp6I GTAC 4 cut(s) 41, 767, 832, 856
CviAII CATG 5 cut(s) 256, 281, 361, 601, 850
CviJI RGCY 9 cut(s) 8, 111, 328, 359, 366, 451, 592, 880, 930
CviKI_1 RGCY 9 cut(s) 8, 111, 328, 359, 366, 451, 592, 880, 930
CviQI GTAC 4 cut(s) 41, 767, 832, 856
DdeI CTNAG 1 cut(s) 185
DpnI GATC 3 cut(s) 125, 145, 267
DpnII GATC 3 cut(s) 123, 143, 265
DriI GACNNNNNGTC 1 cut(s) 790
Eam1104I CTCTTC 2 cut(s) 36, 891
Eam1105I GACNNNNNGTC 1 cut(s) 790
EarI CTCTTC 2 cut(s) 36, 891
EciI GGCGGA 1 cut(s) 309
Eco130I CCWWGG 1 cut(s) 255
Eco31I GGTCTC 1 cut(s) 47
Eco57I CTGAAG 2 cut(s) 17, 915
EcoRI GAATTC 1 cut(s) 680
EcoRII CCWGG 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 255
ErhI CCWWGG 1 cut(s) 255
FaeI CATG 5 cut(s) 259, 284, 364, 604, 853
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FaqI GGGAC 1 cut(s) 40
FatI CATG 5 cut(s) 255, 280, 360, 600, 849
FauI CCCGC 1 cut(s) 548
Fnu4HI GCNGC 3 cut(s) 6, 79, 890
FokI GGATG 1 cut(s) 587
Fsp4HI GCNGC 3 cut(s) 6, 79, 890
FspBI CTAG 1 cut(s) 329
GluI GCNGC 3 cut(s) 6, 79, 890
GsuI CTGGAG 1 cut(s) 65
HaeIII GGCC 1 cut(s) 359
HapII CCGG 1 cut(s) 644
Hin1II CATG 5 cut(s) 259, 284, 364, 604, 853
HindIII AAGCTT 1 cut(s) 590
HinfI GANTC 4 cut(s) 28, 217, 529, 785
HpaII CCGG 1 cut(s) 644
HphI GGTGA 1 cut(s) 202
Hpy166II GTNNAC 2 cut(s) 210, 904
Hpy188I TCNGA 4 cut(s) 13, 36, 325, 534
Hpy188III TCNNGA 2 cut(s) 121, 677
Hpy8I GTNNAC 2 cut(s) 210, 904
Hpy99I CGWCG 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4IV ACGT 2 cut(s) 39, 104
HpyCH4V TGCA 8 cut(s) 371, 428, 457, 488, 672, 715, 823, 916
HpyF10VI GCNNNNNNNGC 1 cut(s) 886
HpyF3I CTNAG 1 cut(s) 185
HpySE526I ACGT 2 cut(s) 39, 104
Hsp92II CATG 5 cut(s) 259, 284, 364, 604, 853
Kzo9I GATC 3 cut(s) 123, 143, 265
LmnI GCTCC 3 cut(s) 46, 325, 885
Lsp1109I GCAGC 2 cut(s) 17, 876
LweI GCATC 2 cut(s) 181, 565
MaeI CTAG 1 cut(s) 329
MaeII ACGT 2 cut(s) 39, 104
MalI GATC 3 cut(s) 125, 145, 267
MboI GATC 3 cut(s) 123, 143, 265
MboII GAAGA 6 cut(s) 23, 61, 296, 791, 794, 908
MflI RGATCY 2 cut(s) 143, 265
MluCI AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
MlyI GAGTC 4 cut(s) 22, 211, 538, 779
MmeI TCCRAC 1 cut(s) 245
MseI TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
MslI CAYNNNNRTG 1 cut(s) 260
MspI CCGG 1 cut(s) 644
MspR9I CCNGG 2 cut(s) 345, 644
Mva1269I GAATGC 3 cut(s) 672, 819, 825
MvaI CCWGG 1 cut(s) 345
MwoI GCNNNNNNNGC 1 cut(s) 886
NciI CCSGG 1 cut(s) 644
NcoI CCATGG 1 cut(s) 255
NdeII GATC 3 cut(s) 123, 143, 265
NheI GCTAGC 1 cut(s) 328
NlaIII CATG 5 cut(s) 259, 284, 364, 604, 853
NlaIV GGNNCC 2 cut(s) 239, 267
NspI RCATGY 1 cut(s) 853
PciI ACATGT 1 cut(s) 849
PctI GAATGC 3 cut(s) 672, 819, 825
PkrI GCNGC 3 cut(s) 7, 80, 891
PleI GAGTC 4 cut(s) 22, 211, 537, 779
PpsI GAGTC 4 cut(s) 22, 211, 537, 779
PscI ACATGT 1 cut(s) 849
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspN4I GGNNCC 2 cut(s) 239, 267
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 143, 265
RsaI GTAC 4 cut(s) 42, 768, 833, 857
RsaNI GTAC 4 cut(s) 41, 767, 832, 856
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
SatI GCNGC 3 cut(s) 6, 79, 890
Sau3AI GATC 3 cut(s) 123, 143, 265
ScaI AGTACT 1 cut(s) 768
SchI GAGTC 4 cut(s) 22, 211, 538, 779
ScrFI CCNGG 2 cut(s) 345, 644
SfaNI GCATC 2 cut(s) 181, 565
SmiMI CAYNNNNRTG 1 cut(s) 260
SmlI CTYRAG 2 cut(s) 59, 593
SmoI CTYRAG 2 cut(s) 59, 593
Sse9I AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
SsiI CCGC 4 cut(s) 78, 294, 519, 541
SspI AATATT 1 cut(s) 751
SspMI CTAG 1 cut(s) 329
StyD4I CCNGG 2 cut(s) 343, 642
StyI CCWWGG 1 cut(s) 255
TaaI ACNGT 1 cut(s) 274
TaiI ACGT 2 cut(s) 42, 107
TaqI TCGA 2 cut(s) 122, 467
TasI AATT 7 cut(s) 383, 512, 563, 632, 680, 728, 797
TatI WGTACW 1 cut(s) 766
TauI GCSGC 1 cut(s) 81
Tru1I TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
Tru9I TTAA 7 cut(s) 231, 380, 524, 624, 759, 804, 867
TscAI CASTG 2 cut(s) 142, 430
TseI GCWGC 2 cut(s) 5, 889
TspDTI ATGAA 5 cut(s) 297, 576, 617, 711, 792
TspRI CASTG 2 cut(s) 142, 430
XapI RAATTY 4 cut(s) 512, 563, 680, 728
XceI RCATGY 1 cut(s) 853
XspI CTAG 1 cut(s) 329
ZrmI AGTACT 1 cut(s) 768
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.