MD03G1004800.v1.1

Belongs to the PTH family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0009564
Physical Location & Seq
Forward (+)
377132 .. 380197
3066 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1004800.v1.1.491

Sequence Viewer

Length: 654 bp
ATGCTTAATTGGTTATGTAGGCGTTGCTTTTGCACGGCTGCTCCACGGCCATGGCTATTTGTAGGTTTGGGCAATCCCGGCGATAAGTACAAAGGAACTAGACACAATACGGGGTTTGAGATGATTGATGCTTTCGCTAATTCACAAGGCATTGCAATGAACACGGTCCATTGCAAAGCTATCTTTGGGCAAGGTTTCGTGGGTGGAGTTCCGGTTTTTCTTGCAAAGCCTCAAACTTATATGAATTTGAGTGGTGAATCTACGGGGCCTCTTGCTGCTTATTATAAGCTACCTCTCAATCGTGTGCTAGTGTTTCATGACGACATGACCTTACCATGCGGGGTACTTCGTCTTCACCCAAATGGAGGTCACTTATGCCACAATGGGCTGAAGAGTGTGATCTATCACTTTCGAGGGAACAGAGAATTTCCTCGACTAAGAATCGGTATCGGAAGGCCTCCTGGTCAAATGGATCCGAAAGCATTCTTGCTGCAAAAATTTAATGCCACAGCTCAAGGACGAATTGATGCTGCTTTGCAAGAGGGAGTTAATATATTGAAGGTCGTGCTTTCTAAAGGCTTTGCAGAAAGTGCAAGACGCTTCAACTCAGAGCAGAAATACAAGCATCTAAGAGTAGAAACCTTGCCAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0004045 GO:0016787 GO:0016788 GO:0052689 GO:0140098 GO:0140101
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pept_tRNA_hydro

Protein Analysis

218

Amino Acids

24.14

Weight (kDa)

9.87

Isoelectric Point (pI)

38.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pept_tRNA_hydro PF01195 19 - 202 1.7e-58 Peptidyl-tRNA hydrolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 285
AciI CCGC 1 cut(s) 339
AclWI GGATC 2 cut(s) 467, 480
AcoI YGGCCR 1 cut(s) 47
AcsI RAATTY 3 cut(s) 244, 425, 497
AcuI CTGAAG 1 cut(s) 410
AfaI GTAC 2 cut(s) 89, 345
AfiI CCNNNNNNNGG 1 cut(s) 365
AgsI TTSAA 2 cut(s) 559, 604
AjnI CCWGG 1 cut(s) 460
AluBI AGCT 3 cut(s) 179, 289, 512
AluI AGCT 3 cut(s) 179, 289, 512
AlwI GGATC 2 cut(s) 467, 480
AoxI GGCC 3 cut(s) 47, 266, 455
ApeKI GCWGC 4 cut(s) 38, 275, 490, 530
ApoI RAATTY 3 cut(s) 244, 425, 497
Asp700I GAANNNNTTC 1 cut(s) 482
AspS9I GGNCC 2 cut(s) 166, 266
AsuC2I CCSGG 1 cut(s) 78
AsuHPI GGTGA 2 cut(s) 266, 347
AvaII GGWCC 1 cut(s) 166
BamHI GGATCC 1 cut(s) 472
BarI GAAGNNNNNNTAC 2 cut(s) 336, 368
BbsI GAAGAC 1 cut(s) 344
BbvI GCAGC 4 cut(s) 25, 262, 477, 517
BceAI ACGGC 2 cut(s) 51, 62
BciT130I CCWGG 1 cut(s) 462
BcnI CCSGG 1 cut(s) 78
BfaI CTAG 2 cut(s) 99, 308
BisI GCNGC 4 cut(s) 39, 276, 491, 531
BlsI GCNGC 4 cut(s) 40, 277, 492, 532
Bme1390I CCNGG 2 cut(s) 78, 462
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 166, 266
BmiI GGNNCC 2 cut(s) 267, 474
BmrFI CCNGG 2 cut(s) 78, 462
BmsI GCATC 3 cut(s) 118, 517, 634
BpiI GAAGAC 1 cut(s) 344
BpuEI CTTGAG 1 cut(s) 498
BpuMI CCSGG 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 44, 50
BsaWI WCCGGW 1 cut(s) 211
BsaXI ACNNNNNCTCC 4 cut(s) 25, 55, 198, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 365
Bse3DI GCAATG 3 cut(s) 150, 162, 169
BseBI CCWGG 1 cut(s) 462
BseDI CCNNGG 2 cut(s) 44, 50
BseLI CCNNNNNNNGG 1 cut(s) 365
BseMI GCAATG 3 cut(s) 150, 162, 169
BseMII CTCAG 1 cut(s) 621
BseXI GCAGC 4 cut(s) 25, 262, 477, 517
BshFI GGCC 3 cut(s) 49, 268, 457
BsiSI CCGG 2 cut(s) 78, 212
BslI CCNNNNNNNGG 1 cut(s) 365
BsmI GAATGC 1 cut(s) 482
BsnI GGCC 3 cut(s) 49, 268, 457
Bsp143I GATC 2 cut(s) 399, 472
Bsp19I CCATGG 1 cut(s) 50
BspACI CCGC 1 cut(s) 339
BspANI GGCC 3 cut(s) 49, 268, 457
BspCNI CTCAG 1 cut(s) 620
BspHI TCATGA 1 cut(s) 316
BspLI GGNNCC 2 cut(s) 267, 474
BspPI GGATC 2 cut(s) 467, 480
BsrDI GCAATG 3 cut(s) 150, 162, 169
BssECI CCNNGG 2 cut(s) 44, 50
BssMI GATC 2 cut(s) 399, 472
BssT1I CCWWGG 1 cut(s) 50
Bst2UI CCWGG 1 cut(s) 462
Bst4CI ACNGT 1 cut(s) 166
Bst6I CTCTTC 1 cut(s) 386
BstAPI GCANNNNNTGC 1 cut(s) 590
BstDEI CTNAG 3 cut(s) 437, 607, 629
BstDSI CCRYGG 2 cut(s) 44, 50
BstKTI GATC 2 cut(s) 402, 475
BstMBI GATC 2 cut(s) 399, 472
BstMWI GCNNNNNNNGC 2 cut(s) 78, 590
BstNI CCWGG 1 cut(s) 462
BstSCI CCNGG 2 cut(s) 76, 460
BstV1I GCAGC 4 cut(s) 25, 262, 477, 517
BstV2I GAAGAC 1 cut(s) 344
BstX2I RGATCY 1 cut(s) 472
BstXI CCANNNNNNTGG 1 cut(s) 51
BstYI RGATCY 1 cut(s) 472
BsuRI GGCC 3 cut(s) 49, 268, 457
BtgI CCRYGG 2 cut(s) 44, 50
CciI TCATGA 1 cut(s) 316
Cfr13I GGNCC 2 cut(s) 166, 266
CseI GACGC 1 cut(s) 606
Csp6I GTAC 2 cut(s) 88, 344
CviAII CATG 5 cut(s) 51, 317, 325, 336, 651
CviQI GTAC 2 cut(s) 88, 344
DdeI CTNAG 3 cut(s) 437, 607, 629
DpnI GATC 2 cut(s) 401, 474
DpnII GATC 2 cut(s) 399, 472
EaeI YGGCCR 1 cut(s) 47
Eam1104I CTCTTC 1 cut(s) 386
EarI CTCTTC 1 cut(s) 386
Eco130I CCWWGG 1 cut(s) 50
Eco147I AGGCCT 1 cut(s) 457
Eco47I GGWCC 1 cut(s) 166
Eco57I CTGAAG 1 cut(s) 410
EcoO109I RGGNCCY 1 cut(s) 266
EcoRII CCWGG 1 cut(s) 460
EcoT14I CCWWGG 1 cut(s) 50
ErhI CCWWGG 1 cut(s) 50
FaeI CATG 5 cut(s) 54, 320, 328, 339, 654
FatI CATG 5 cut(s) 50, 316, 324, 335, 650
FauI CCCGC 1 cut(s) 332
Fnu4HI GCNGC 4 cut(s) 39, 276, 491, 531
Fsp4HI GCNGC 4 cut(s) 39, 276, 491, 531
FspBI CTAG 2 cut(s) 99, 308
GluI GCNGC 4 cut(s) 39, 276, 491, 531
HaeIII GGCC 3 cut(s) 49, 268, 457
HapII CCGG 2 cut(s) 78, 212
HgaI GACGC 1 cut(s) 606
Hin1II CATG 5 cut(s) 54, 320, 328, 339, 654
HinfI GANTC 2 cut(s) 257, 441
HpaII CCGG 2 cut(s) 78, 212
HphI GGTGA 2 cut(s) 266, 347
Hpy188I TCNGA 3 cut(s) 452, 477, 610
Hpy188III TCNNGA 1 cut(s) 317
HpyAV CCTTC 2 cut(s) 447, 553
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4V TGCA 8 cut(s) 33, 155, 174, 224, 493, 538, 584, 593
HpyF10VI GCNNNNNNNGC 2 cut(s) 78, 590
HpyF3I CTNAG 3 cut(s) 437, 607, 629
Hsp92II CATG 5 cut(s) 54, 320, 328, 339, 654
Kzo9I GATC 2 cut(s) 399, 472
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 4 cut(s) 91, 225, 447, 474
Lsp1109I GCAGC 4 cut(s) 25, 262, 477, 517
LweI GCATC 3 cut(s) 118, 517, 634
MaeI CTAG 2 cut(s) 99, 308
MaeIII GTNAC 1 cut(s) 368
MalI GATC 2 cut(s) 401, 474
MboI GATC 2 cut(s) 399, 472
MboII GAAGA 2 cut(s) 344, 403
MflI RGATCY 1 cut(s) 472
MluCI AATT 6 cut(s) 7, 139, 244, 425, 497, 522
MnlI CCTC 8 cut(s) 240, 279, 303, 359, 407, 441, 468, 535
MroXI GAANNNNTTC 1 cut(s) 482
MseI TTAA 3 cut(s) 6, 501, 549
MslI CAYNNNNRTG 3 cut(s) 49, 155, 360
MspI CCGG 2 cut(s) 78, 212
MspR9I CCNGG 2 cut(s) 78, 462
Mva1269I GAATGC 1 cut(s) 482
MvaI CCWGG 1 cut(s) 462
MwoI GCNNNNNNNGC 2 cut(s) 78, 590
NciI CCSGG 1 cut(s) 78
NcoI CCATGG 1 cut(s) 50
NdeII GATC 2 cut(s) 399, 472
NlaIII CATG 5 cut(s) 54, 320, 328, 339, 654
NlaIV GGNNCC 2 cut(s) 267, 474
NmuCI GTSAC 1 cut(s) 368
PagI TCATGA 1 cut(s) 316
PceI AGGCCT 1 cut(s) 457
PctI GAATGC 1 cut(s) 482
PdmI GAANNNNTTC 1 cut(s) 482
PfeI GAWTC 2 cut(s) 257, 441
PkrI GCNGC 4 cut(s) 40, 277, 492, 532
PsiI TTATAA 1 cut(s) 285
Psp6I CCWGG 1 cut(s) 460
PspGI CCWGG 1 cut(s) 460
PspN4I GGNNCC 2 cut(s) 267, 474
PspPI GGNCC 2 cut(s) 166, 266
PsuI RGATCY 1 cut(s) 472
RsaI GTAC 2 cut(s) 89, 345
RsaNI GTAC 2 cut(s) 88, 344
RseI CAYNNNNRTG 3 cut(s) 49, 155, 360
SaqAI TTAA 3 cut(s) 6, 501, 549
SatI GCNGC 4 cut(s) 39, 276, 491, 531
Sau3AI GATC 2 cut(s) 399, 472
Sau96I GGNCC 2 cut(s) 166, 266
ScrFI CCNGG 2 cut(s) 78, 462
SfaNI GCATC 3 cut(s) 118, 517, 634
SinI GGWCC 1 cut(s) 166
SmiMI CAYNNNNRTG 3 cut(s) 49, 155, 360
SmlI CTYRAG 1 cut(s) 513
SmoI CTYRAG 1 cut(s) 513
Sse9I AATT 6 cut(s) 7, 139, 244, 425, 497, 522
SseBI AGGCCT 1 cut(s) 457
SsiI CCGC 1 cut(s) 339
SspMI CTAG 2 cut(s) 99, 308
StuI AGGCCT 1 cut(s) 457
StyD4I CCNGG 2 cut(s) 76, 460
StyI CCWWGG 1 cut(s) 50
TaaI ACNGT 1 cut(s) 166
TaqI TCGA 2 cut(s) 412, 433
TasI AATT 6 cut(s) 7, 139, 244, 425, 497, 522
TatI WGTACW 1 cut(s) 87
TfiI GAWTC 2 cut(s) 257, 441
Tru1I TTAA 3 cut(s) 6, 501, 549
Tru9I TTAA 3 cut(s) 6, 501, 549
TseFI GTSAC 1 cut(s) 368
TseI GCWGC 4 cut(s) 38, 275, 490, 530
Tsp45I GTSAC 1 cut(s) 368
TspDTI ATGAA 3 cut(s) 173, 257, 305
VpaK11BI GGWCC 1 cut(s) 166
XapI RAATTY 3 cut(s) 244, 425, 497
XmnI GAANNNNTTC 1 cut(s) 482
XspI CTAG 2 cut(s) 99, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.