MD04G1053300.v1.1

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
6307538 .. 6307720
183 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1053300.v1.1.491

Sequence Viewer

Length: 183 bp
ATGATGGTTGATCGTTTGTTCGAGGACATATTTCAGATTCTGCGATTGAACCCAGATGGCGAAAAGTTCGATAAAGTTACTCGAGTAGAAGCAAAGAGTGAGACTTGCGAGATGTTCATGCACCTGGATGTGAATTCAGAGGTTTATCTGATGAGGGAAGGGCAATCGCAAGACATTGGCTGA

Protein Analysis

61

Amino Acids

7.09

Weight (kDa)

4.49

Isoelectric Point (pI)

37.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb8 PF03870 8 - 56 3.2e-14 RNA polymerase Rpb8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 133
AgsI TTSAA 1 cut(s) 49
AjnI CCWGG 1 cut(s) 123
Alw26I GTCTC 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 40
Ama87I CYCGRG 1 cut(s) 81
ApoI RAATTY 1 cut(s) 133
AvaI CYCGRG 1 cut(s) 81
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 95
Bme1390I CCNGG 1 cut(s) 125
BmeT110I CYCGRG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 125
BseGI GGATG 1 cut(s) 133
BsiHKCI CYCGRG 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 81
Bsp143I GATC 1 cut(s) 10
BssMI GATC 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 95
BstMBI GATC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 123
BtsCI GGATG 1 cut(s) 133
CaiI CAGNNNCTG 1 cut(s) 40
CviAII CATG 1 cut(s) 118
CviJI RGCY 1 cut(s) 180
CviKI_1 RGCY 1 cut(s) 180
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco88I CYCGRG 1 cut(s) 81
EcoRI GAATTC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 123
FaeI CATG 1 cut(s) 121
FaiI YATR 2 cut(s) 29, 119
FatI CATG 1 cut(s) 117
FokI GGATG 1 cut(s) 140
Hin1II CATG 1 cut(s) 121
HinfI GANTC 1 cut(s) 37
Hpy188I TCNGA 3 cut(s) 36, 139, 150
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 121
Hsp92II CATG 1 cut(s) 121
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 3 cut(s) 66, 110, 137
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MluCI AATT 1 cut(s) 133
MnlI CCTC 3 cut(s) 16, 133, 147
MslI CAYNNNNRTG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 125
MvaI CCWGG 1 cut(s) 125
NdeII GATC 1 cut(s) 10
NlaIII CATG 1 cut(s) 121
PaeR7I CTCGAG 1 cut(s) 81
PfeI GAWTC 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 123
PspGI CCWGG 1 cut(s) 123
PspXI VCTCGAGB 1 cut(s) 81
PstNI CAGNNNCTG 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 126
Sau3AI GATC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 125
SetI ASST 2 cut(s) 126, 144
Sfr274I CTCGAG 1 cut(s) 81
SgeI CNNG 9 cut(s) 34, 65, 93, 95, 117, 121, 130, 136, 137
SlaI CTCGAG 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 126
SmlI CTYRAG 1 cut(s) 81
SmoI CTYRAG 1 cut(s) 81
Sse9I AATT 1 cut(s) 133
StyD4I CCNGG 1 cut(s) 123
TaqI TCGA 3 cut(s) 21, 69, 82
TasI AATT 1 cut(s) 133
TfiI GAWTC 1 cut(s) 37
TspDTI ATGAA 1 cut(s) 106
XapI RAATTY 1 cut(s) 133
XhoI CTCGAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.