MD05G1057600.v1.1

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
10027346 .. 10027543
198 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1057600.v1.1.491

Sequence Viewer

Length: 198 bp
ATGTTCAAATCGTCAAGGATGGTTGATCGTCTGTTTGATGACATATTTCAGATTCTACGATTGAACCCAAATGGCAAAAAGTTCGATAAAGTTACTCGAGTAAAAGCAAAGAGTGAGACTTGCGAAATGTTCATGTACCTAGATGTGAATTCAGAGGTGTATCCGATGAGGGAAGGGCAATCGCAAGACATTGGCTGA

Protein Analysis

66

Amino Acids

7.68

Weight (kDa)

7.86

Isoelectric Point (pI)

31.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb8 PF03870 13 - 61 7.7e-15 RNA polymerase Rpb8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AfaI GTAC 1 cut(s) 137
AgsI TTSAA 2 cut(s) 7, 64
Alw26I GTCTC 1 cut(s) 110
Ama87I CYCGRG 1 cut(s) 96
ApoI RAATTY 1 cut(s) 148
AvaI CYCGRG 1 cut(s) 96
BccI CCATC 1 cut(s) 13
BcgI CGANNNNNNTGC 2 cut(s) 64, 98
BciVI GTATCC 1 cut(s) 171
BcoDI GTCTC 1 cut(s) 110
BfaI CTAG 1 cut(s) 140
BfuI GTATCC 1 cut(s) 171
BmeT110I CYCGRG 1 cut(s) 96
BseGI GGATG 1 cut(s) 24
BsiHKCI CYCGRG 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 110
BsoBI CYCGRG 1 cut(s) 96
Bsp143I GATC 1 cut(s) 25
BssMI GATC 1 cut(s) 25
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 1 cut(s) 25
BsuI GTATCC 1 cut(s) 171
BtsCI GGATG 1 cut(s) 24
Csp6I GTAC 1 cut(s) 136
CviAII CATG 1 cut(s) 133
CviJI RGCY 1 cut(s) 195
CviKI_1 RGCY 1 cut(s) 195
CviQI GTAC 1 cut(s) 136
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Eco88I CYCGRG 1 cut(s) 96
EcoRI GAATTC 1 cut(s) 148
FaeI CATG 1 cut(s) 136
FaiI YATR 2 cut(s) 44, 134
FatI CATG 1 cut(s) 132
FokI GGATG 1 cut(s) 31
FspBI CTAG 1 cut(s) 140
Hin1II CATG 1 cut(s) 136
HinfI GANTC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 51, 154, 165
HpyAV CCTTC 1 cut(s) 167
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 1 cut(s) 25
MaeI CTAG 1 cut(s) 140
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MluCI AATT 1 cut(s) 148
MnlI CCTC 2 cut(s) 148, 162
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 136
PaeR7I CTCGAG 1 cut(s) 96
PfeI GAWTC 1 cut(s) 52
PspXI VCTCGAGB 1 cut(s) 96
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 25
SetI ASST 2 cut(s) 141, 159
Sfr274I CTCGAG 1 cut(s) 96
SgeI CNNG 6 cut(s) 27, 108, 110, 132, 145, 152
SlaI CTCGAG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
Sse9I AATT 1 cut(s) 148
SspMI CTAG 1 cut(s) 140
TaqI TCGA 2 cut(s) 84, 97
TasI AATT 1 cut(s) 148
TfiI GAWTC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 121
XapI RAATTY 1 cut(s) 148
XhoI CTCGAG 1 cut(s) 96
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.