Rorug05G0275100

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
31084278 .. 31084553
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0275100.1

Sequence Viewer

Length: 276 bp
ATGGATGATAACATATTCCCGGAGCCATCTAAGTTTGATCCAAGTAGGTTCGACAAGCAAGCAACAGTTCCACCCTACTGCTTTGTACCATTTGGAGGGGGACCTAGAATATGTCCAGGATATGAGGTTGCCAGGATCGAAACCCTAATTGCAATACACCATATGGTAACTCAATTCACTTGGAAGCTATGTGCAGACAATCACTTCAGTAGGGATCTAATGCCTGTACCTACTCAAGGACTGCCCATTGAAATCACGCCTAGAATTCTACTGTGA

Protein Analysis

91

Amino Acids

10.34

Weight (kDa)

5.81

Isoelectric Point (pI)

61.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 2 - 69 1.3e-19 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 32, 143, 222
AcsI RAATTY 1 cut(s) 264
AcuI CTGAAG 1 cut(s) 190
AfaI GTAC 2 cut(s) 87, 228
AfiI CCNNNNNNNGG 2 cut(s) 95, 236
AgsI TTSAA 1 cut(s) 251
AjnI CCWGG 2 cut(s) 115, 131
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
AlwI GGATC 3 cut(s) 32, 143, 222
ApoI RAATTY 1 cut(s) 264
AspS9I GGNCC 1 cut(s) 101
AsuC2I CCSGG 1 cut(s) 20
AvaII GGWCC 1 cut(s) 101
BccI CCATC 1 cut(s) 34
BciT130I CCWGG 2 cut(s) 117, 133
BcnI CCSGG 1 cut(s) 20
BfaI CTAG 2 cut(s) 105, 261
Bme1390I CCNGG 3 cut(s) 20, 117, 133
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 2 cut(s) 24, 102
BmrFI CCNGG 3 cut(s) 20, 117, 133
BpuEI CTTGAG 1 cut(s) 219
BpuMI CCSGG 1 cut(s) 20
Bsc4I CCNNNNNNNGG 2 cut(s) 95, 236
BseBI CCWGG 2 cut(s) 117, 133
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 95, 236
BsgI GTGCAG 1 cut(s) 213
BsiSI CCGG 1 cut(s) 20
BslFI GGGAC 1 cut(s) 114
BslI CCNNNNNNNGG 2 cut(s) 95, 236
BsmFI GGGAC 1 cut(s) 114
Bsp143I GATC 3 cut(s) 37, 135, 214
BspLI GGNNCC 2 cut(s) 24, 102
BspPI GGATC 3 cut(s) 32, 143, 222
BssMI GATC 3 cut(s) 37, 135, 214
Bst2UI CCWGG 2 cut(s) 117, 133
Bst4CI ACNGT 2 cut(s) 67, 273
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 30
BstENI CCTNNNNNAGG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 3 cut(s) 40, 138, 217
BstMBI GATC 3 cut(s) 37, 135, 214
BstNI CCWGG 2 cut(s) 117, 133
BstSCI CCNGG 3 cut(s) 18, 115, 131
BstX2I RGATCY 1 cut(s) 214
BstYI RGATCY 1 cut(s) 214
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 101
Csp6I GTAC 2 cut(s) 86, 227
CviJI RGCY 2 cut(s) 25, 187
CviKI_1 RGCY 2 cut(s) 25, 187
CviQI GTAC 2 cut(s) 86, 227
DdeI CTNAG 1 cut(s) 30
DpnI GATC 3 cut(s) 39, 137, 216
DpnII GATC 3 cut(s) 37, 135, 214
Eco47I GGWCC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 190
EcoNI CCTNNNNNAGG 1 cut(s) 234
EcoO109I RGGNCCY 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 264
EcoRII CCWGG 2 cut(s) 115, 131
FaiI YATR 6 cut(s) 14, 112, 123, 162, 164, 190
FaqI GGGAC 1 cut(s) 114
FauNDI CATATG 1 cut(s) 162
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 105, 261
HapII CCGG 1 cut(s) 20
HpaII CCGG 1 cut(s) 20
HpyCH4III ACNGT 2 cut(s) 67, 273
HpyCH4V TGCA 2 cut(s) 152, 194
HpyF3I CTNAG 1 cut(s) 30
Kzo9I GATC 3 cut(s) 37, 135, 214
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 6 cut(s) 33, 102, 118, 129, 145, 237
MaeI CTAG 2 cut(s) 105, 261
MaeIII GTNAC 1 cut(s) 166
MalI GATC 3 cut(s) 39, 137, 216
MboI GATC 3 cut(s) 37, 135, 214
MflI RGATCY 1 cut(s) 214
MluCI AATT 3 cut(s) 147, 173, 264
MnlI CCTC 2 cut(s) 89, 118
MspI CCGG 1 cut(s) 20
MspR9I CCNGG 3 cut(s) 20, 117, 133
MvaI CCWGG 2 cut(s) 117, 133
NciI CCSGG 1 cut(s) 20
NdeI CATATG 1 cut(s) 162
NdeII GATC 3 cut(s) 37, 135, 214
NlaIV GGNNCC 2 cut(s) 24, 102
PfoI TCCNGGA 2 cut(s) 18, 115
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
Psp6I CCWGG 2 cut(s) 115, 131
PspGI CCWGG 2 cut(s) 115, 131
PspN4I GGNNCC 2 cut(s) 24, 102
PspPI GGNCC 1 cut(s) 101
PspPPI RGGWCCY 1 cut(s) 101
PsuI RGATCY 1 cut(s) 214
RsaI GTAC 2 cut(s) 87, 228
RsaNI GTAC 2 cut(s) 86, 227
Sau3AI GATC 3 cut(s) 37, 135, 214
Sau96I GGNCC 1 cut(s) 101
ScrFI CCNGG 3 cut(s) 20, 117, 133
SetI ASST 5 cut(s) 50, 106, 129, 189, 232
SinI GGWCC 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 234
SmoI CTYRAG 1 cut(s) 234
Sse9I AATT 3 cut(s) 147, 173, 264
SspMI CTAG 2 cut(s) 105, 261
StyD4I CCNGG 3 cut(s) 18, 115, 131
TaaI ACNGT 2 cut(s) 67, 273
TaqI TCGA 2 cut(s) 51, 138
TasI AATT 3 cut(s) 147, 173, 264
VpaK11BI GGWCC 1 cut(s) 101
XagI CCTNNNNNAGG 1 cut(s) 234
XapI RAATTY 1 cut(s) 264
XspI CTAG 2 cut(s) 105, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.