pycom03g13240

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Reverse (-)
14177921 .. 14180742
2822 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g13240.1

Sequence Viewer

Length: 225 bp
ATGTTCATGGATGTGGATGTGAATTCAGAGGTGTATCCGATGAGGGAAGGTGAGAAATTCTCAATGGCTTTAACTTCCACAATCAATTTGGATGGAACTCCTGCTACTAGTTATTTCACCCAGGGCAATCGCAGGACATTGGCTGATGAATATGAGTCTGTCATGCAAGGGAAGCTTTTTAAGATTTCAGAAGGTTCTAAACGTGATCCAAAAGCTTACGTATAA

Protein Analysis

75

Amino Acids

8.38

Weight (kDa)

4.96

Isoelectric Point (pI)

17.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb8 PF03870 1 - 70 4e-17 RNA polymerase Rpb8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 200
AcsI RAATTY 2 cut(s) 22, 56
AhlI ACTAGT 1 cut(s) 107
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 2 cut(s) 175, 215
AluI AGCT 2 cut(s) 175, 215
AlwI GGATC 1 cut(s) 200
ApoI RAATTY 2 cut(s) 22, 56
AsuHPI GGTGA 2 cut(s) 62, 109
BccI CCATC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 122
BciVI GTATCC 1 cut(s) 45
BcuI ACTAGT 1 cut(s) 107
BfaI CTAG 1 cut(s) 108
BfuI GTATCC 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 122
BplI GAGNNNNNCTC 2 cut(s) 44, 76
BsaAI YACGTR 1 cut(s) 220
BsaJI CCNNGG 2 cut(s) 120, 121
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 120, 121
BseGI GGATG 3 cut(s) 16, 22, 97
Bsp143I GATC 1 cut(s) 205
BspPI GGATC 1 cut(s) 200
BssECI CCNNGG 2 cut(s) 120, 121
BssMI GATC 1 cut(s) 205
Bst2UI CCWGG 1 cut(s) 122
BstBAI YACGTR 1 cut(s) 220
BstF5I GGATG 3 cut(s) 16, 22, 97
BstKTI GATC 1 cut(s) 208
BstMBI GATC 1 cut(s) 205
BstMWI GCNNNNNNNGC 1 cut(s) 172
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 120
BstSNI TACGTA 1 cut(s) 220
BsuI GTATCC 1 cut(s) 45
BtsCI GGATG 3 cut(s) 16, 22, 97
CviAII CATG 2 cut(s) 7, 163
CviJI RGCY 4 cut(s) 68, 143, 175, 215
CviKI_1 RGCY 4 cut(s) 68, 143, 175, 215
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
Eco105I TACGTA 1 cut(s) 220
EcoRI GAATTC 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 120
FaeI CATG 2 cut(s) 10, 166
FaiI YATR 4 cut(s) 8, 153, 164, 223
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FatI CATG 2 cut(s) 6, 162
FokI GGATG 3 cut(s) 23, 29, 104
FspBI CTAG 1 cut(s) 108
Hin1II CATG 2 cut(s) 10, 166
HindIII AAGCTT 2 cut(s) 173, 213
HinfI GANTC 1 cut(s) 155
HphI GGTGA 2 cut(s) 62, 109
Hpy188I TCNGA 3 cut(s) 28, 39, 190
HpyAV CCTTC 2 cut(s) 41, 185
HpyCH4IV ACGT 2 cut(s) 202, 219
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpySE526I ACGT 2 cut(s) 202, 219
Hsp92II CATG 2 cut(s) 10, 166
Kzo9I GATC 1 cut(s) 205
LpnPI CCDG 4 cut(s) 107, 114, 118, 134
MaeI CTAG 1 cut(s) 108
MaeII ACGT 2 cut(s) 202, 219
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MluCI AATT 3 cut(s) 22, 56, 85
MlyI GAGTC 1 cut(s) 164
MnlI CCTC 2 cut(s) 22, 36
MseI TTAA 2 cut(s) 71, 180
MslI CAYNNNNRTG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 172
NdeII GATC 1 cut(s) 205
NlaIII CATG 2 cut(s) 10, 166
PasI CCCWGGG 1 cut(s) 121
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
Ppu21I YACGTR 1 cut(s) 220
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PsrI GAACNNNNNNTAC 2 cut(s) 88, 120
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 2 cut(s) 71, 180
Sau3AI GATC 1 cut(s) 205
SchI GAGTC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 122
SetI ASST 7 cut(s) 33, 52, 177, 196, 205, 217, 222
SgeI CNNG 9 cut(s) 19, 113, 120, 133, 134, 145, 175, 179, 215
SmiMI CAYNNNNRTG 1 cut(s) 11
SnaBI TACGTA 1 cut(s) 220
SpeI ACTAGT 1 cut(s) 107
Sse9I AATT 3 cut(s) 22, 56, 85
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 120
TaiI ACGT 2 cut(s) 205, 222
TasI AATT 3 cut(s) 22, 56, 85
Tru1I TTAA 2 cut(s) 71, 180
Tru9I TTAA 2 cut(s) 71, 180
TspDTI ATGAA 1 cut(s) 162
XapI RAATTY 2 cut(s) 22, 56
XcmI CCANNNNNNNNNTGG 1 cut(s) 85
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.