Rmu_sc0032204.1_g000001

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032204.1
Physical Location & Seq
Forward (+)
1 .. 2342
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032204.1_g000001.1.cds

Sequence Viewer

Length: 414 bp
gatatatttcaggtgttgcgactgaacccagatggaaaaaagtttgataaagttacccgagttgaagcaaagagtgaggcttgcgagatgttcatgcaccttgatgtgaattcagaggtgtaccccatcaaagaaggcgagaagttctccatggctcttacttctacacttaatttggatggaacacctgacactggctatttcaccccgggcaatcgcaagactttggctgatgaatatgaatatgtcatgcaagggaagctttacaaaatttcagaaggctctaaacgtgatcctaaagcggaggtaaatgcttcatttggtgggctcttaatgatgctgaagggggaatccgctcaattcaagaactttgaacttgatcagaggttgtttctcctcattaggaagttgtga

Protein Analysis

137

Amino Acids

15.61

Weight (kDa)

5.93

Isoelectric Point (pI)

11.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 356
AciI CCGC 2 cut(s) 302, 354
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 2 cut(s) 109, 270
AcuI CTGAAG 1 cut(s) 362
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 3 cut(s) 65, 364, 374
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
AlwI GGATC 1 cut(s) 287
Ama87I CYCGRG 2 cut(s) 57, 208
ApoI RAATTY 2 cut(s) 109, 270
AsuC2I CCSGG 2 cut(s) 209, 210
AsuHPI GGTGA 1 cut(s) 196
AvaI CYCGRG 2 cut(s) 57, 208
BanII GRGCYC 1 cut(s) 330
BccI CCATC 3 cut(s) 26, 134, 173
BclI TGATCA 1 cut(s) 379
BcnI CCSGG 2 cut(s) 209, 210
Bme1390I CCNGG 2 cut(s) 209, 210
BmeT110I CYCGRG 2 cut(s) 57, 208
BmrFI CCNGG 2 cut(s) 209, 210
BmsI GCATC 1 cut(s) 327
BplI GAGNNNNNCTC 2 cut(s) 131, 163
BpuMI CCSGG 2 cut(s) 209, 210
BsaJI CCNNGG 3 cut(s) 150, 207, 208
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 199
BseDI CCNNGG 3 cut(s) 150, 207, 208
BseGI GGATG 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 194
BseNI ACTGG 1 cut(s) 199
BseRI GAGGAG 1 cut(s) 386
BsiHKCI CYCGRG 2 cut(s) 57, 208
BsiSI CCGG 1 cut(s) 209
BslI CCNNNNNNNGG 1 cut(s) 194
BsoBI CYCGRG 2 cut(s) 57, 208
Bsp1286I GDGCHC 1 cut(s) 330
Bsp143I GATC 2 cut(s) 292, 379
Bsp19I CCATGG 1 cut(s) 150
BspACI CCGC 2 cut(s) 302, 354
BspPI GGATC 1 cut(s) 287
BsrBI CCGCTC 1 cut(s) 356
BsrI ACTGG 1 cut(s) 199
BssECI CCNNGG 3 cut(s) 150, 207, 208
BssMI GATC 2 cut(s) 292, 379
BssT1I CCWWGG 1 cut(s) 150
BstC8I GCNNGC 1 cut(s) 82
BstDSI CCRYGG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 2 cut(s) 295, 382
BstMBI GATC 2 cut(s) 292, 379
BstMWI GCNNNNNNNGC 1 cut(s) 259
BstSCI CCNGG 2 cut(s) 207, 208
BtgI CCRYGG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 184
BtsIMutI CAGTG 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 82
Cfr9I CCCGGG 1 cut(s) 208
Csp6I GTAC 1 cut(s) 121
CviAII CATG 3 cut(s) 94, 151, 250
CviJI RGCY 7 cut(s) 80, 155, 198, 230, 262, 282, 328
CviKI_1 RGCY 7 cut(s) 80, 155, 198, 230, 262, 282, 328
CviQI GTAC 1 cut(s) 121
DpnI GATC 2 cut(s) 294, 381
DpnII GATC 2 cut(s) 292, 379
Eco130I CCWWGG 1 cut(s) 150
Eco24I GRGCYC 1 cut(s) 330
Eco57I CTGAAG 1 cut(s) 362
Eco88I CYCGRG 2 cut(s) 57, 208
EcoRI GAATTC 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 150
EcoT38I GRGCYC 1 cut(s) 330
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 3 cut(s) 97, 154, 253
FaiI YATR 6 cut(s) 5, 95, 152, 240, 246, 251
FalI AAGNNNNNCTT 2 cut(s) 246, 278
FatI CATG 3 cut(s) 93, 150, 249
FbaI TGATCA 1 cut(s) 379
FokI GGATG 1 cut(s) 191
FriOI GRGCYC 1 cut(s) 330
HapII CCGG 1 cut(s) 209
Hin1II CATG 3 cut(s) 97, 154, 253
HindIII AAGCTT 1 cut(s) 260
HinfI GANTC 1 cut(s) 350
HpaII CCGG 1 cut(s) 209
HphI GGTGA 1 cut(s) 196
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 3 cut(s) 115, 277, 384
Hpy188III TCNNGA 1 cut(s) 364
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 3 cut(s) 128, 272, 337
HpyCH4IV ACGT 1 cut(s) 289
HpyCH4V TGCA 2 cut(s) 97, 253
HpyF10VI GCNNNNNNNGC 1 cut(s) 259
HpySE526I ACGT 1 cut(s) 289
Hsp92II CATG 3 cut(s) 97, 154, 253
Ksp22I TGATCA 1 cut(s) 379
Kzo9I GATC 2 cut(s) 292, 379
LpnPI CCDG 4 cut(s) 42, 180, 201, 222
LweI GCATC 1 cut(s) 327
MaeII ACGT 1 cut(s) 289
MaeIII GTNAC 1 cut(s) 52
MalI GATC 2 cut(s) 294, 381
MbiI CCGCTC 1 cut(s) 356
MboI GATC 2 cut(s) 292, 379
MhlI GDGCHC 1 cut(s) 330
MluCI AATT 4 cut(s) 109, 172, 270, 359
MnlI CCTC 5 cut(s) 70, 109, 298, 378, 407
MseI TTAA 2 cut(s) 171, 332
MslI CAYNNNNRTG 1 cut(s) 102
MspI CCGG 1 cut(s) 209
MspR9I CCNGG 2 cut(s) 209, 210
MwoI GCNNNNNNNGC 1 cut(s) 259
NciI CCSGG 2 cut(s) 209, 210
NcoI CCATGG 1 cut(s) 150
NdeII GATC 2 cut(s) 292, 379
NlaIII CATG 3 cut(s) 97, 154, 253
PfeI GAWTC 1 cut(s) 350
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 2 cut(s) 171, 332
Sau3AI GATC 2 cut(s) 292, 379
ScrFI CCNGG 2 cut(s) 209, 210
SduI GDGCHC 1 cut(s) 330
SetI ASST 8 cut(s) 15, 102, 120, 190, 264, 292, 309, 389
SfaNI GCATC 1 cut(s) 327
SmaI CCCGGG 1 cut(s) 210
SmiMI CAYNNNNRTG 1 cut(s) 102
Sse9I AATT 4 cut(s) 109, 172, 270, 359
SsiI CCGC 2 cut(s) 302, 354
StyD4I CCNGG 2 cut(s) 207, 208
StyI CCWWGG 1 cut(s) 150
TaiI ACGT 1 cut(s) 292
TasI AATT 4 cut(s) 109, 172, 270, 359
TfiI GAWTC 1 cut(s) 350
Tru1I TTAA 2 cut(s) 171, 332
Tru9I TTAA 2 cut(s) 171, 332
TscAI CASTG 1 cut(s) 199
TspDTI ATGAA 4 cut(s) 82, 249, 255, 306
TspMI CCCGGG 1 cut(s) 208
TspRI CASTG 1 cut(s) 199
XapI RAATTY 2 cut(s) 109, 270
XmaI CCCGGG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.