Rroxscaffold_1G00027860

DNA-directed RNA polymerases

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
35451028 .. 35456916
5889 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00027860.1

Sequence Viewer

Length: 435 bp
ATGGTTGATCGTCTTTTTGAGGATATCTTTCAAATACTACAGTTAAACCCAGATGGAAAAAAGTTTGATAAGGTTACTCGAATTGAAGCAAAAAGTGAGACATGCGAGATGTTCATGCACCTAGATGTGAATACAGAGGTGTATCCCATGAAGGAAGGTGAGAAGTTCTCAATGGCTCTAACTTCTACACTCAACTTGGATGGAACACCTGACACTGGCTATTTCACTCCGGGAAATCGCAAGACGTTGGCTGATGAATATGAGTATGTCATGCAAGGGAAGCTTTTTAAAATCTCAGAAGGTTCTAAACGGGATCCTAAAGCGGAGGTAAATGCTTCATTTGCTGGGCTGTTGATGATGCTCAAGGGGGAATCCTCTCAATTCAAGAACTTTGAACTGGATCAAAGGCTGTTTCTCCTCATCAGGAAGCTATAG

Protein Analysis

144

Amino Acids

16.58

Weight (kDa)

5.29

Isoelectric Point (pI)

14.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb8 PF03870 7 - 143 3.5e-49 RNA polymerase Rpb8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 323
AclWI GGATC 3 cut(s) 308, 321, 408
AfiI CCNNNNNNNGG 1 cut(s) 215
AgsI TTSAA 4 cut(s) 32, 86, 385, 395
AluBI AGCT 2 cut(s) 283, 430
AluI AGCT 2 cut(s) 283, 430
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 3 cut(s) 308, 321, 408
AsuC2I CCSGG 1 cut(s) 231
AsuHPI GGTGA 1 cut(s) 170
BamHI GGATCC 1 cut(s) 313
BccI CCATC 2 cut(s) 47, 194
BciVI GTATCC 1 cut(s) 153
BcnI CCSGG 1 cut(s) 231
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 122
BfmI CTRYAG 2 cut(s) 38, 431
BfuI GTATCC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 231
BmiI GGNNCC 1 cut(s) 315
BmrFI CCNGG 1 cut(s) 231
BmsI GCATC 1 cut(s) 348
BplI GAGNNNNNCTC 2 cut(s) 152, 184
BpuEI CTTGAG 1 cut(s) 347
BpuMI CCSGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 1 cut(s) 215
Bse1I ACTGG 2 cut(s) 220, 402
BseGI GGATG 1 cut(s) 205
BseLI CCNNNNNNNGG 1 cut(s) 215
BseMII CTCAG 1 cut(s) 309
BseNI ACTGG 2 cut(s) 220, 402
BseRI GAGGAG 1 cut(s) 407
BseYI CCCAGC 1 cut(s) 344
BsiSI CCGG 1 cut(s) 230
BslI CCNNNNNNNGG 1 cut(s) 215
BsmAI GTCTC 1 cut(s) 92
Bsp143I GATC 3 cut(s) 7, 313, 400
BspACI CCGC 1 cut(s) 323
BspCNI CTCAG 1 cut(s) 308
BspLI GGNNCC 1 cut(s) 315
BspPI GGATC 3 cut(s) 308, 321, 408
BsrI ACTGG 2 cut(s) 220, 402
BssMI GATC 3 cut(s) 7, 313, 400
Bst4CI ACNGT 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 295
BstF5I GGATG 1 cut(s) 205
BstKTI GATC 3 cut(s) 10, 316, 403
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 3 cut(s) 7, 313, 400
BstMWI GCNNNNNNNGC 2 cut(s) 280, 341
BstNSI RCATGY 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 229
BstSFI CTRYAG 2 cut(s) 38, 431
BstX2I RGATCY 1 cut(s) 313
BstYI RGATCY 1 cut(s) 313
BsuI GTATCC 1 cut(s) 153
BtsCI GGATG 1 cut(s) 205
BtsIMutI CAGTG 1 cut(s) 213
CviAII CATG 4 cut(s) 102, 115, 148, 271
CviJI RGCY 7 cut(s) 176, 219, 251, 283, 349, 409, 430
CviKI_1 RGCY 7 cut(s) 176, 219, 251, 283, 349, 409, 430
DdeI CTNAG 1 cut(s) 295
DpnI GATC 3 cut(s) 9, 315, 402
DpnII GATC 3 cut(s) 7, 313, 400
DraI TTTAAA 1 cut(s) 289
Eco32I GATATC 1 cut(s) 25
EcoRV GATATC 1 cut(s) 25
FaeI CATG 4 cut(s) 105, 118, 151, 274
FaiI YATR 7 cut(s) 103, 116, 149, 261, 267, 272, 433
FalI AAGNNNNNCTT 2 cut(s) 267, 299
FatI CATG 4 cut(s) 101, 114, 147, 270
FokI GGATG 1 cut(s) 212
FspBI CTAG 1 cut(s) 122
GsaI CCCAGC 1 cut(s) 348
HapII CCGG 1 cut(s) 230
Hin1II CATG 4 cut(s) 105, 118, 151, 274
HindIII AAGCTT 1 cut(s) 281
HinfI GANTC 1 cut(s) 371
HpaII CCGG 1 cut(s) 230
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 298
Hpy188III TCNNGA 2 cut(s) 385, 424
HpyAV CCTTC 3 cut(s) 145, 149, 293
HpyCH4III ACNGT 1 cut(s) 42
HpyCH4IV ACGT 1 cut(s) 245
HpyCH4V TGCA 2 cut(s) 118, 274
HpyF10VI GCNNNNNNNGC 2 cut(s) 280, 341
HpyF3I CTNAG 1 cut(s) 295
HpySE526I ACGT 1 cut(s) 245
Hsp92II CATG 4 cut(s) 105, 118, 151, 274
Kzo9I GATC 3 cut(s) 7, 313, 400
LpnPI CCDG 7 cut(s) 63, 201, 222, 243, 330, 383, 409
LweI GCATC 1 cut(s) 348
MaeI CTAG 1 cut(s) 122
MaeII ACGT 1 cut(s) 245
MaeIII GTNAC 1 cut(s) 73
MalI GATC 3 cut(s) 9, 315, 402
MboI GATC 3 cut(s) 7, 313, 400
MflI RGATCY 1 cut(s) 313
MluCI AATT 2 cut(s) 81, 380
MnlI CCTC 5 cut(s) 13, 130, 319, 385, 428
MseI TTAA 2 cut(s) 44, 288
MslI CAYNNNNRTG 1 cut(s) 123
MspI CCGG 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 231
MwoI GCNNNNNNNGC 2 cut(s) 280, 341
NciI CCSGG 1 cut(s) 231
NdeII GATC 3 cut(s) 7, 313, 400
NlaIII CATG 4 cut(s) 105, 118, 151, 274
NlaIV GGNNCC 1 cut(s) 315
NspI RCATGY 1 cut(s) 105
PfeI GAWTC 1 cut(s) 371
PfoI TCCNGGA 1 cut(s) 229
PspFI CCCAGC 1 cut(s) 344
PspN4I GGNNCC 1 cut(s) 315
PsuI RGATCY 1 cut(s) 313
RseI CAYNNNNRTG 1 cut(s) 123
SaqAI TTAA 2 cut(s) 44, 288
Sau3AI GATC 3 cut(s) 7, 313, 400
ScrFI CCNGG 1 cut(s) 231
SfaNI GCATC 1 cut(s) 348
SfcI CTRYAG 2 cut(s) 38, 431
SmiMI CAYNNNNRTG 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 362
SmoI CTYRAG 1 cut(s) 362
Sse9I AATT 2 cut(s) 81, 380
SsiI CCGC 1 cut(s) 323
SspMI CTAG 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 229
TaaI ACNGT 1 cut(s) 42
TaiI ACGT 1 cut(s) 248
TaqI TCGA 1 cut(s) 79
TasI AATT 2 cut(s) 81, 380
TfiI GAWTC 1 cut(s) 371
Tru1I TTAA 2 cut(s) 44, 288
Tru9I TTAA 2 cut(s) 44, 288
TscAI CASTG 1 cut(s) 220
TspDTI ATGAA 4 cut(s) 103, 164, 270, 327
TspRI CASTG 1 cut(s) 220
XceI RCATGY 1 cut(s) 105
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.