MD04G1223600.v1.1

Aldo/keto reductase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
30368500 .. 30368718
219 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1223600.v1.1.491

Sequence Viewer

Length: 219 bp
ATGCTTGCAAAAGATATATTTTGGCAATCTACACGTGTCAAAGTTGGTTTTTATTTTATTTTATGCCTAGGACTTACTGGAAACTACAATTCCCCTGTCCCTGAAGGTGTCGGCATGTCAATCATCAAATTAACTTTCAAAAGCACGATCATATTCTTCGACACTGCAGATGTTTATGGTCCCTACACGAACCAAGTAATGCTGGCAAAGGTAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.09

Weight (kDa)

9.21

Isoelectric Point (pI)

26.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017738)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 123
AcvI CACGTG 1 cut(s) 35
AflIII ACRYGT 2 cut(s) 32, 34
AgsI TTSAA 1 cut(s) 139
AspA2I CCTAGG 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 179
AvaII GGWCC 1 cut(s) 179
AvrII CCTAGG 1 cut(s) 67
BbrPI CACGTG 1 cut(s) 35
BfaI CTAG 1 cut(s) 68
BfmI CTRYAG 1 cut(s) 165
BlnI CCTAGG 1 cut(s) 67
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 181
BsaAI YACGTR 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 82
BslFI GGGAC 2 cut(s) 83, 165
BsmFI GGGAC 2 cut(s) 83, 165
Bsp143I GATC 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 181
BspMAI CTGCAG 1 cut(s) 169
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 67
BstBAI YACGTR 1 cut(s) 35
BstC8I GCNNGC 2 cut(s) 6, 204
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 165
BtsI GCAGTG 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 162
Cac8I GCNNGC 2 cut(s) 6, 204
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 1 cut(s) 115
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 179
Eco57I CTGAAG 1 cut(s) 123
Eco72I CACGTG 1 cut(s) 35
EcoT14I CCWWGG 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 67
FaeI CATG 1 cut(s) 118
FaiI YATR 5 cut(s) 17, 64, 116, 152, 177
FaqI GGGAC 2 cut(s) 83, 165
FatI CATG 1 cut(s) 114
FspBI CTAG 1 cut(s) 68
Hin1II CATG 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 34
HpyCH4V TGCA 2 cut(s) 8, 167
HpySE526I ACGT 1 cut(s) 34
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 4 cut(s) 63, 108, 114, 188
MaeI CTAG 1 cut(s) 68
MaeII ACGT 1 cut(s) 34
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 1 cut(s) 148
MluCI AATT 2 cut(s) 88, 128
MseI TTAA 1 cut(s) 131
NdeII GATC 1 cut(s) 147
NlaIII CATG 1 cut(s) 118
NlaIV GGNNCC 1 cut(s) 181
NspI RCATGY 1 cut(s) 118
PmaCI CACGTG 1 cut(s) 35
PmlI CACGTG 1 cut(s) 35
Ppu21I YACGTR 1 cut(s) 35
PspCI CACGTG 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 181
PspPI GGNCC 1 cut(s) 179
PstI CTGCAG 1 cut(s) 169
SaqAI TTAA 1 cut(s) 131
Sau3AI GATC 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 179
SetI ASST 3 cut(s) 37, 109, 213
SfcI CTRYAG 1 cut(s) 165
SinI GGWCC 1 cut(s) 179
Sse9I AATT 2 cut(s) 88, 128
SspMI CTAG 1 cut(s) 68
StyI CCWWGG 1 cut(s) 67
TaiI ACGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 159
TasI AATT 2 cut(s) 88, 128
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TscAI CASTG 1 cut(s) 169
TspRI CASTG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 179
XceI RCATGY 1 cut(s) 118
XmaJI CCTAGG 1 cut(s) 67
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.