Rh6DG190400

Lysine-specific histone demethylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
34057470 .. 34063967
6498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG190400.1

Sequence Viewer

Length: 150 bp
ATGAAGGTCATAGAGCAAGCCACTGATGCAGAGAAAGCAACGGCTATGTGTGAGTTTCTTGATTTCAAGCGCAGGAACAAGGAGAGGCTGAAAGAAGTTATTGAACAAATCACGAGCTGTAGCTTCTTGGTGAGTAGTCTGTTGTCTTAA

Protein Analysis

49

Amino Acids

5.64

Weight (kDa)

6.16

Isoelectric Point (pI)

63.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017738)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 67, 104
AluBI AGCT 2 cut(s) 117, 123
AluI AGCT 2 cut(s) 117, 123
AspLEI GCGC 1 cut(s) 72
AsuHPI GGTGA 1 cut(s) 142
BauI CACGAG 1 cut(s) 112
BceAI ACGGC 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 118
BmsI GCATC 1 cut(s) 16
BssSI CACGAG 1 cut(s) 112
Bst2BI CACGAG 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 18
BstHHI GCGC 1 cut(s) 72
BstMWI GCNNNNNNNGC 2 cut(s) 26, 35
BstSFI CTRYAG 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 18
CfoI GCGC 1 cut(s) 72
CviJI RGCY 5 cut(s) 20, 44, 88, 117, 123
CviKI_1 RGCY 5 cut(s) 20, 44, 88, 117, 123
FaiI YATR 2 cut(s) 11, 47
FspEI CC 6 cut(s) 26, 34, 58, 65, 70, 113
GlaI GCGC 1 cut(s) 71
HhaI GCGC 1 cut(s) 72
Hin6I GCGC 1 cut(s) 70
HinP1I GCGC 1 cut(s) 70
HphI GGTGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 59, 112
HpyCH4V TGCA 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 35
HspAI GCGC 1 cut(s) 70
LpnPI CCDG 1 cut(s) 58
LweI GCATC 1 cut(s) 16
MnlI CCTC 1 cut(s) 78
MseI TTAA 1 cut(s) 148
MwoI GCNNNNNNNGC 2 cut(s) 26, 35
SaqAI TTAA 1 cut(s) 148
SetI ASST 3 cut(s) 9, 119, 125
SfaNI GCATC 1 cut(s) 16
SfcI CTRYAG 1 cut(s) 118
SgeI CNNG 8 cut(s) 29, 71, 79, 85, 91, 124, 126, 139
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.