MD05G1301600.v1.1

Heavy metal-associated isoprenylated plant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0011538
Physical Location & Seq
Reverse (-)
43436570 .. 43437410
841 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1301600.v1.1.491

Sequence Viewer

Length: 486 bp
ATGATAGTGACCATGGATTGTGCTGGCTGCGAGAATAAGATTAGGAGTTCTCTAAAAAAGCTGAAGGATGCTGTAGATGTGGACTTCAACATGCAAAAGGTAACTGTAACGGGATGGGCTGATCAAGAGAAAGTTCTGAGGGCAGTGAGGAAGACTGGAAAGAGAGCTGAGCTTTGGCCTTACCCTTACAACCCTGAGTACCACAACTTTGGCCTTGACTACTATCAACAACATCAGCCGCTTGATCTGAATCATCATCATAAGCATCATCATAACCGTCAGATTACCACCCACCATCTGCCCATCACTACCTACATTTCAGTACCTAAATCCTCCTCCTCATCATATTCCTACAACTACTATGAACATGGCTCCACTAATCAGGACACTGGCTACTATCAACCCCCTCCTTATTTCACCATGTTTAATGAGCAGGACACTGCTGTGTTCAGTGATGACAATCCTCATGCTTGTTCCATAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

162

Amino Acids

18.8

Weight (kDa)

6.62

Isoelectric Point (pI)

33.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 2 - 54 1.4e-13 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 239
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 2 cut(s) 200, 324
AgsI TTSAA 1 cut(s) 88
AleI CACNNNNGTG 1 cut(s) 443
AluBI AGCT 3 cut(s) 61, 167, 172
AluI AGCT 3 cut(s) 61, 167, 172
AoxI GGCC 2 cut(s) 176, 211
ApeKI GCWGC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 409
BbsI GAAGAC 1 cut(s) 158
BbvI GCAGC 1 cut(s) 14
BccI CCATC 3 cut(s) 108, 303, 311
BclI TGATCA 1 cut(s) 121
BfmI CTRYAG 1 cut(s) 72
BisI GCNGC 2 cut(s) 28, 239
BlpI GCTNAGC 1 cut(s) 168
BlsI GCNGC 2 cut(s) 29, 240
BmiI GGNNCC 1 cut(s) 373
BmsI GCATC 2 cut(s) 58, 274
BpiI GAAGAC 1 cut(s) 158
Bpu1102I GCTNAGC 1 cut(s) 168
BsaBI GATNNNNATC 2 cut(s) 249, 459
BsaJI CCNNGG 1 cut(s) 12
Bse1I ACTGG 2 cut(s) 160, 394
Bse8I GATNNNNATC 2 cut(s) 249, 459
BseDI CCNNGG 1 cut(s) 12
BseGI GGATG 2 cut(s) 73, 119
BseJI GATNNNNATC 2 cut(s) 249, 459
BseMII CTCAG 3 cut(s) 128, 159, 186
BseNI ACTGG 2 cut(s) 160, 394
BseRI GAGGAG 2 cut(s) 325, 328
BseXI GCAGC 1 cut(s) 14
BshFI GGCC 2 cut(s) 178, 213
BsnI GGCC 2 cut(s) 178, 213
Bsp143I GATC 2 cut(s) 121, 244
Bsp1720I GCTNAGC 1 cut(s) 168
Bsp19I CCATGG 1 cut(s) 12
BspACI CCGC 1 cut(s) 239
BspANI GGCC 2 cut(s) 178, 213
BspCNI CTCAG 3 cut(s) 129, 160, 187
BspLI GGNNCC 1 cut(s) 373
BsrI ACTGG 2 cut(s) 160, 394
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 2 cut(s) 121, 244
BssT1I CCWWGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 106, 278
BstC8I GCNNGC 1 cut(s) 25
BstDEI CTNAG 3 cut(s) 137, 168, 195
BstDSI CCRYGG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 73, 119
BstKTI GATC 2 cut(s) 124, 247
BstMBI GATC 2 cut(s) 121, 244
BstNSI RCATGY 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 72
BstV1I GCAGC 1 cut(s) 14
BstV2I GAAGAC 1 cut(s) 158
BstXI CCANNNNNNTGG 1 cut(s) 209
BsuRI GGCC 2 cut(s) 178, 213
BtgI CCRYGG 1 cut(s) 12
BtsCI GGATG 2 cut(s) 73, 119
BtsI GCAGTG 2 cut(s) 150, 438
BtsIMutI CAGTG 4 cut(s) 150, 387, 438, 457
Cac8I GCNNGC 1 cut(s) 25
Csp6I GTAC 2 cut(s) 199, 323
CviAII CATG 5 cut(s) 13, 91, 368, 421, 467
CviQI GTAC 2 cut(s) 199, 323
DdeI CTNAG 3 cut(s) 137, 168, 195
DpnI GATC 2 cut(s) 123, 246
DpnII GATC 2 cut(s) 121, 244
Eco130I CCWWGG 1 cut(s) 12
Eco57I CTGAAG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 5 cut(s) 16, 94, 371, 424, 470
FatI CATG 5 cut(s) 12, 90, 367, 420, 466
FbaI TGATCA 1 cut(s) 121
Fnu4HI GCNGC 2 cut(s) 28, 239
FokI GGATG 2 cut(s) 80, 126
Fsp4HI GCNGC 2 cut(s) 28, 239
GluI GCNGC 2 cut(s) 28, 239
HaeIII GGCC 2 cut(s) 178, 213
Hin1II CATG 5 cut(s) 16, 94, 371, 424, 470
HinfI GANTC 1 cut(s) 250
HphI GGTGA 1 cut(s) 409
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 3 cut(s) 138, 249, 282
Hpy188III TCNNGA 2 cut(s) 125, 383
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 2 cut(s) 106, 278
HpyCH4V TGCA 1 cut(s) 94
HpyF3I CTNAG 3 cut(s) 137, 168, 195
Hsp92II CATG 5 cut(s) 16, 94, 371, 424, 470
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 121, 244
LmnI GCTCC 1 cut(s) 377
LpnPI CCDG 6 cut(s) 9, 141, 207, 368, 375, 419
Lsp1109I GCAGC 1 cut(s) 14
LweI GCATC 2 cut(s) 58, 274
MaeIII GTNAC 3 cut(s) 7, 100, 106
MalI GATC 2 cut(s) 123, 246
MboI GATC 2 cut(s) 121, 244
MboII GAAGA 1 cut(s) 163
MnlI CCTC 7 cut(s) 132, 141, 343, 346, 349, 417, 474
MseI TTAA 1 cut(s) 426
MslI CAYNNNNRTG 1 cut(s) 443
NcoI CCATGG 1 cut(s) 12
NdeII GATC 2 cut(s) 121, 244
NlaIII CATG 5 cut(s) 16, 94, 371, 424, 470
NlaIV GGNNCC 1 cut(s) 373
NmuCI GTSAC 1 cut(s) 7
NspI RCATGY 1 cut(s) 94
OliI CACNNNNGTG 1 cut(s) 443
PfeI GAWTC 1 cut(s) 250
PkrI GCNGC 2 cut(s) 29, 240
PspN4I GGNNCC 1 cut(s) 373
RsaI GTAC 2 cut(s) 200, 324
RsaNI GTAC 2 cut(s) 199, 323
RseI CAYNNNNRTG 1 cut(s) 443
SaqAI TTAA 1 cut(s) 426
SatI GCNGC 2 cut(s) 28, 239
Sau3AI GATC 2 cut(s) 121, 244
SetI ASST 6 cut(s) 63, 102, 169, 174, 314, 328
SfaNI GCATC 2 cut(s) 58, 274
SfcI CTRYAG 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 443
SsiI CCGC 1 cut(s) 239
StyI CCWWGG 1 cut(s) 12
TaaI ACNGT 2 cut(s) 106, 278
TauI GCSGC 1 cut(s) 241
TfiI GAWTC 1 cut(s) 250
Tru1I TTAA 1 cut(s) 426
Tru9I TTAA 1 cut(s) 426
TscAI CASTG 4 cut(s) 150, 394, 445, 457
TseFI GTSAC 1 cut(s) 7
TseI GCWGC 1 cut(s) 27
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 1 cut(s) 378
TspRI CASTG 4 cut(s) 150, 394, 445, 457
XceI RCATGY 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.