Rmu_co8000780.1_g000001

Heavy metal-associated isoprenylated plant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8000780.1
OG0011538
Physical Location & Seq
Reverse (-)
65 .. 454
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8000780.1_g000001.1.cds

Sequence Viewer

Length: 390 bp
atgcagaaggtgactgtcatgggatgggctaaacaagagaaagttttaagggcagtgaggaggactggaaggacagctgagctttggccttacccttacaaccctgaatatggacacaactttaatgttcagtactaccagcagcatcaaccccgcgatggccgcgaacatcaccaccaccgccaccatcatgatcatcaaagtaaacacaagatcaccacctacaattcgattcccaattactcgtcttattcgtacaattactacaagcatggctacagtggcaaggagcatggctattatcagcctcctccttactccaccatgtttaatgagcaggacactgctgtgttcagtgatgaaaaccctcatgcctgttccattatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

129

Amino Acids

15.53

Weight (kDa)

8.89

Isoelectric Point (pI)

36.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 156, 165
AciI CCGC 3 cut(s) 154, 163, 181
AcoI YGGCCR 1 cut(s) 160
AfaI GTAC 2 cut(s) 134, 257
AfiI CCNNNNNNNGG 2 cut(s) 110, 158
AleI CACNNNNGTG 1 cut(s) 347
AluBI AGCT 2 cut(s) 77, 82
AluI AGCT 2 cut(s) 77, 82
AoxI GGCC 2 cut(s) 86, 160
ApeKI GCWGC 1 cut(s) 142
AsuHPI GGTGA 3 cut(s) 22, 164, 208
BbvI GCAGC 1 cut(s) 154
BccI CCATC 3 cut(s) 18, 152, 195
BclI TGATCA 1 cut(s) 193
BfmI CTRYAG 1 cut(s) 277
BisI GCNGC 2 cut(s) 143, 163
BlpI GCTNAGC 1 cut(s) 78
BlsI GCNGC 2 cut(s) 144, 164
BmcAI AGTACT 1 cut(s) 134
BmsI GCATC 1 cut(s) 154
Bpu1102I GCTNAGC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 158
Bse1I ACTGG 1 cut(s) 70
BseGI GGATG 1 cut(s) 29
BseLI CCNNNNNNNGG 2 cut(s) 110, 158
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 70
BseRI GAGGAG 2 cut(s) 73, 300
BseXI GCAGC 1 cut(s) 154
Bsh1236I CGCG 2 cut(s) 156, 165
BshFI GGCC 2 cut(s) 88, 162
BslI CCNNNNNNNGG 2 cut(s) 110, 158
BsnI GGCC 2 cut(s) 88, 162
Bsp143I GATC 2 cut(s) 193, 213
Bsp1720I GCTNAGC 1 cut(s) 78
BspACI CCGC 3 cut(s) 154, 163, 181
BspANI GGCC 2 cut(s) 88, 162
BspCNI CTCAG 1 cut(s) 70
BspFNI CGCG 2 cut(s) 156, 165
BspHI TCATGA 1 cut(s) 190
BsrI ACTGG 1 cut(s) 70
BssMI GATC 2 cut(s) 193, 213
Bst4CI ACNGT 2 cut(s) 16, 281
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 29
BstFNI CGCG 2 cut(s) 156, 165
BstKTI GATC 2 cut(s) 196, 216
BstMBI GATC 2 cut(s) 193, 213
BstMWI GCNNNNNNNGC 2 cut(s) 162, 282
BstSFI CTRYAG 1 cut(s) 277
BstUI CGCG 2 cut(s) 156, 165
BstV1I GCAGC 1 cut(s) 154
BsuRI GGCC 2 cut(s) 88, 162
BtgZI GCGATG 1 cut(s) 171
BtsCI GGATG 1 cut(s) 29
BtsI GCAGTG 2 cut(s) 60, 342
BtsIMutI CAGTG 4 cut(s) 60, 286, 342, 361
CciI TCATGA 1 cut(s) 190
Csp6I GTAC 2 cut(s) 133, 256
CviAII CATG 6 cut(s) 19, 191, 272, 293, 325, 371
CviJI RGCY 8 cut(s) 29, 77, 82, 88, 162, 276, 297, 307
CviKI_1 RGCY 8 cut(s) 29, 77, 82, 88, 162, 276, 297, 307
CviQI GTAC 2 cut(s) 133, 256
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 195, 215
DpnII GATC 2 cut(s) 193, 213
EaeI YGGCCR 1 cut(s) 160
FaeI CATG 6 cut(s) 22, 194, 275, 296, 328, 374
FaiI YATR 8 cut(s) 20, 111, 192, 273, 294, 326, 372, 386
FatI CATG 6 cut(s) 18, 190, 271, 292, 324, 370
FauI CCCGC 1 cut(s) 161
FbaI TGATCA 1 cut(s) 193
Fnu4HI GCNGC 2 cut(s) 143, 163
FokI GGATG 1 cut(s) 36
Fsp4HI GCNGC 2 cut(s) 143, 163
GluI GCNGC 2 cut(s) 143, 163
HaeIII GGCC 2 cut(s) 88, 162
Hin1II CATG 6 cut(s) 22, 194, 275, 296, 328, 374
HinfI GANTC 1 cut(s) 232
HphI GGTGA 3 cut(s) 22, 164, 208
Hpy166II GTNNAC 1 cut(s) 206
Hpy188III TCNNGA 1 cut(s) 191
Hpy8I GTNNAC 1 cut(s) 206
HpyAV CCTTC 1 cut(s) 63
HpyCH4III ACNGT 2 cut(s) 16, 281
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 2 cut(s) 162, 282
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 6 cut(s) 22, 194, 275, 296, 328, 374
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 193, 213
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 4 cut(s) 51, 117, 152, 323
Lsp1109I GCAGC 1 cut(s) 154
LweI GCATC 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 10
MalI GATC 2 cut(s) 195, 215
MboI GATC 2 cut(s) 193, 213
MluCI AATT 3 cut(s) 226, 238, 259
MnlI CCTC 5 cut(s) 51, 54, 318, 321, 378
MseI TTAA 3 cut(s) 47, 123, 330
MslI CAYNNNNRTG 2 cut(s) 189, 347
MspA1I CMGCKG 1 cut(s) 77
MvnI CGCG 2 cut(s) 156, 165
MwoI GCNNNNNNNGC 2 cut(s) 162, 282
NdeII GATC 2 cut(s) 193, 213
NlaIII CATG 6 cut(s) 22, 194, 275, 296, 328, 374
NmuCI GTSAC 1 cut(s) 10
OliI CACNNNNGTG 1 cut(s) 347
PagI TCATGA 1 cut(s) 190
PcsI WCGNNNNNNNCGW 1 cut(s) 251
PfeI GAWTC 1 cut(s) 232
PkrI GCNGC 2 cut(s) 144, 164
PvuII CAGCTG 1 cut(s) 77
RsaI GTAC 2 cut(s) 134, 257
RsaNI GTAC 2 cut(s) 133, 256
RseI CAYNNNNRTG 2 cut(s) 189, 347
SaqAI TTAA 3 cut(s) 47, 123, 330
SatI GCNGC 2 cut(s) 143, 163
Sau3AI GATC 2 cut(s) 193, 213
ScaI AGTACT 1 cut(s) 134
SetI ASST 4 cut(s) 12, 79, 84, 224
SfaNI GCATC 1 cut(s) 154
SfcI CTRYAG 1 cut(s) 277
SmiMI CAYNNNNRTG 2 cut(s) 189, 347
Sse9I AATT 3 cut(s) 226, 238, 259
SsiI CCGC 3 cut(s) 154, 163, 181
TaaI ACNGT 2 cut(s) 16, 281
TaqI TCGA 1 cut(s) 230
TasI AATT 3 cut(s) 226, 238, 259
TatI WGTACW 1 cut(s) 132
TauI GCSGC 1 cut(s) 165
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 3 cut(s) 47, 123, 330
Tru9I TTAA 3 cut(s) 47, 123, 330
TscAI CASTG 4 cut(s) 60, 286, 349, 361
TseFI GTSAC 1 cut(s) 10
TseI GCWGC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 10
TspDTI ATGAA 1 cut(s) 375
TspRI CASTG 4 cut(s) 60, 286, 349, 361
ZrmI AGTACT 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.