pycom05g27940

Heavy metal-associated isoprenylated plant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0011538
Physical Location & Seq
Reverse (-)
28794754 .. 28795588
835 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g27940.1

Sequence Viewer

Length: 492 bp
ATGATAGTGACCATGGATTGTGCTGGCTGCGAGAATAAGATTAGGAGTTCTCTAAAAAAGCTGAAAGGAGTAGATGCTGTTGATGTGGACTTCAACATGCAAAAGGTGACTGTAATGGGATGGGTTGATCAAGAGAAAGTTCTGAGGGCAGTGAGGAAGACTGGAAAAAGAGCCGAGCTTTGGCCTTACCCTTACAACCCTGAGTACCACAACTTTGGCCTTGACTACTATCAACAACATCAGCCGCTTGATCTGGATCATCATCATAAGCATCATCATAACCGTCAGATTACCACCCACCATCTGCCCATCACTACCTACATTTCAGTACCTAAATCCTCCTCCTCATCATATTCCTACAACTACTATAAACATGGCTCCACTAATCAGGAACATGGCTACTATCAACCCCCTCCGTATTCCACCATGTTTAATGAGCAGGACATTGATGTGTTCAGTGATGACAATCCTCATGCTTGTTCCATAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

164

Amino Acids

19.06

Weight (kDa)

6.66

Isoelectric Point (pI)

35.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 2 - 56 1.3e-17 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 245
AclWI GGATC 1 cut(s) 264
AfaI GTAC 2 cut(s) 206, 330
AfiI CCNNNNNNNGG 1 cut(s) 180
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 2 cut(s) 61, 178
AluI AGCT 2 cut(s) 61, 178
AlwI GGATC 1 cut(s) 264
AoxI GGCC 2 cut(s) 182, 217
ApeKI GCWGC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 118
BbsI GAAGAC 1 cut(s) 164
BbvI GCAGC 1 cut(s) 14
BccI CCATC 3 cut(s) 114, 309, 317
BclI TGATCA 1 cut(s) 127
BisI GCNGC 2 cut(s) 28, 245
BlsI GCNGC 2 cut(s) 29, 246
BmiI GGNNCC 1 cut(s) 379
BmsI GCATC 2 cut(s) 64, 280
BpiI GAAGAC 1 cut(s) 164
BsaBI GATNNNNATC 3 cut(s) 255, 261, 465
BsaJI CCNNGG 1 cut(s) 12
Bsc4I CCNNNNNNNGG 1 cut(s) 180
Bse1I ACTGG 1 cut(s) 166
Bse8I GATNNNNATC 3 cut(s) 255, 261, 465
BseDI CCNNGG 1 cut(s) 12
BseGI GGATG 1 cut(s) 125
BseJI GATNNNNATC 3 cut(s) 255, 261, 465
BseLI CCNNNNNNNGG 1 cut(s) 180
BseMII CTCAG 2 cut(s) 134, 192
BseNI ACTGG 1 cut(s) 166
BseRI GAGGAG 2 cut(s) 331, 334
BseXI GCAGC 1 cut(s) 14
BshFI GGCC 2 cut(s) 184, 219
BslI CCNNNNNNNGG 1 cut(s) 180
BsnI GGCC 2 cut(s) 184, 219
Bsp143I GATC 3 cut(s) 127, 250, 256
Bsp19I CCATGG 1 cut(s) 12
BspACI CCGC 1 cut(s) 245
BspANI GGCC 2 cut(s) 184, 219
BspCNI CTCAG 2 cut(s) 135, 193
BspLI GGNNCC 1 cut(s) 379
BspPI GGATC 1 cut(s) 264
BsrI ACTGG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 3 cut(s) 127, 250, 256
BssT1I CCWWGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 112, 284
BstC8I GCNNGC 1 cut(s) 25
BstDEI CTNAG 2 cut(s) 143, 201
BstDSI CCRYGG 1 cut(s) 12
BstF5I GGATG 1 cut(s) 125
BstKTI GATC 3 cut(s) 130, 253, 259
BstMBI GATC 3 cut(s) 127, 250, 256
BstNSI RCATGY 1 cut(s) 100
BstV1I GCAGC 1 cut(s) 14
BstV2I GAAGAC 1 cut(s) 164
BstXI CCANNNNNNTGG 1 cut(s) 215
BsuRI GGCC 2 cut(s) 184, 219
BtgI CCRYGG 1 cut(s) 12
BtsCI GGATG 1 cut(s) 125
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 2 cut(s) 156, 463
Cac8I GCNNGC 1 cut(s) 25
Csp6I GTAC 2 cut(s) 205, 329
CviAII CATG 6 cut(s) 13, 97, 374, 395, 427, 473
CviJI RGCY 9 cut(s) 27, 61, 173, 178, 184, 219, 244, 378, 399
CviKI_1 RGCY 9 cut(s) 27, 61, 173, 178, 184, 219, 244, 378, 399
CviQI GTAC 2 cut(s) 205, 329
DdeI CTNAG 2 cut(s) 143, 201
DpnI GATC 3 cut(s) 129, 252, 258
DpnII GATC 3 cut(s) 127, 250, 256
Eco130I CCWWGG 1 cut(s) 12
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 6 cut(s) 16, 100, 377, 398, 430, 476
FatI CATG 6 cut(s) 12, 96, 373, 394, 426, 472
FbaI TGATCA 1 cut(s) 127
Fnu4HI GCNGC 2 cut(s) 28, 245
FokI GGATG 1 cut(s) 132
Fsp4HI GCNGC 2 cut(s) 28, 245
GluI GCNGC 2 cut(s) 28, 245
HaeIII GGCC 2 cut(s) 184, 219
Hin1II CATG 6 cut(s) 16, 100, 377, 398, 430, 476
HphI GGTGA 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 144, 288
Hpy188III TCNNGA 3 cut(s) 131, 254, 389
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 2 cut(s) 112, 284
HpyCH4V TGCA 1 cut(s) 100
HpyF3I CTNAG 2 cut(s) 143, 201
Hsp92II CATG 6 cut(s) 16, 100, 377, 398, 430, 476
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 3 cut(s) 127, 250, 256
LmnI GCTCC 1 cut(s) 383
LpnPI CCDG 6 cut(s) 9, 147, 213, 239, 374, 425
Lsp1109I GCAGC 1 cut(s) 14
LweI GCATC 2 cut(s) 64, 280
MaeIII GTNAC 2 cut(s) 7, 106
MalI GATC 3 cut(s) 129, 252, 258
MboI GATC 3 cut(s) 127, 250, 256
MboII GAAGA 1 cut(s) 169
MnlI CCTC 7 cut(s) 138, 147, 349, 352, 355, 423, 480
MseI TTAA 1 cut(s) 432
MslI CAYNNNNRTG 1 cut(s) 449
NcoI CCATGG 1 cut(s) 12
NdeII GATC 3 cut(s) 127, 250, 256
NlaIII CATG 6 cut(s) 16, 100, 377, 398, 430, 476
NlaIV GGNNCC 1 cut(s) 379
NmeAIII GCCGAG 1 cut(s) 199
NmuCI GTSAC 2 cut(s) 7, 106
NspI RCATGY 1 cut(s) 100
PkrI GCNGC 2 cut(s) 29, 246
PspN4I GGNNCC 1 cut(s) 379
RsaI GTAC 2 cut(s) 206, 330
RsaNI GTAC 2 cut(s) 205, 329
RseI CAYNNNNRTG 1 cut(s) 449
SaqAI TTAA 1 cut(s) 432
SatI GCNGC 2 cut(s) 28, 245
Sau3AI GATC 3 cut(s) 127, 250, 256
SetI ASST 5 cut(s) 63, 108, 180, 320, 334
SfaNI GCATC 2 cut(s) 64, 280
SmiMI CAYNNNNRTG 1 cut(s) 449
SsiI CCGC 1 cut(s) 245
StyI CCWWGG 1 cut(s) 12
TaaI ACNGT 2 cut(s) 112, 284
TauI GCSGC 1 cut(s) 247
Tru1I TTAA 1 cut(s) 432
Tru9I TTAA 1 cut(s) 432
TscAI CASTG 2 cut(s) 156, 463
TseFI GTSAC 2 cut(s) 7, 106
TseI GCWGC 1 cut(s) 27
Tsp45I GTSAC 2 cut(s) 7, 106
TspGWI ACGGA 1 cut(s) 405
TspRI CASTG 2 cut(s) 156, 463
XceI RCATGY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.