MD06G1167700.v1.1

RIBOSOMAL protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0013552
Physical Location & Seq
Reverse (-)
30773252 .. 30773650
399 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1167700.v1.1.491

Sequence Viewer

Length: 399 bp
ATGGGAAACAGATTGGGAAGGAGGGTAGTCCACTTCGCAAAACTACCCATCAAGCTTCTGATGCCCAACAACTTCACCAGCATCATAGAAATTGCTCTCAAAACCATCTCATCGGCCTCCAAGATCGAAATCAATCACGTCATGGAGTCTCTCTACGGATTCCAGGTCGACAAGGTCCACACCCTCAACATGGAGGGCAAGAAGAAGAAGCGTGATGGTCTTCTCATCGTAAAATCCGATTACAAGAAGGCCTACGTCACCCTCAAGGCTACCATCTCTCTCTCCCAAAACCTCTACCTTATCGGAATAGTCCAACAGCACCACAACCGAAGAAGACCAAAAAACAACATAACAAGTACAAGTGTTCTGATCTCAACTTGGATCTTTCAATTGGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L23

Protein Analysis

133

Amino Acids

15.06

Weight (kDa)

10.39

Isoelectric Point (pI)

36.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L23 PF00276 33 - 90 1.6e-13 Ribosomal protein L23
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013552)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G39880
fragaria_vesca FvH4_1g20880 FvH4_1g20880 FvH4_1g20880
malus_domestica MD01G1030100.v1.1 MD06G1167700.v1.1 MD15G1324000.v1.1
prunus_persica Prupe.6G187100_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0113491
rosa_laevigata RLG00000018069
rosa_multiflora Rmu_sc0007415.1_g000021
rosa_roxburghii Rroxscaffold_2G00129200
rosa_rugosa Rorug02G0187900
rosa_samantha Rh2AG242400 Rh2CG246600 Rh2DG250400
rosa_wichuraiana Rw0G018890 Rw2G018950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 168
AclWI GGATC 1 cut(s) 389
AfaI GTAC 1 cut(s) 358
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 389
AjiI CACGTC 1 cut(s) 139
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
Alw26I GTCTC 1 cut(s) 153
AlwI GGATC 1 cut(s) 389
AoxI GGCC 2 cut(s) 114, 249
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 2 cut(s) 67, 250
AvaII GGWCC 1 cut(s) 175
BbsI GAAGAC 2 cut(s) 212, 340
BccI CCATC 4 cut(s) 56, 113, 209, 281
BciT130I CCWGG 1 cut(s) 164
BcoDI GTCTC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 175
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 164
BmsI GCATC 2 cut(s) 51, 90
BpiI GAAGAC 2 cut(s) 212, 340
BpuEI CTTGAG 1 cut(s) 248
BsaBI GATNNNNATC 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse8I GATNNNNATC 1 cut(s) 128
BseBI CCWGG 1 cut(s) 164
BseJI GATNNNNATC 1 cut(s) 128
BseLI CCNNNNNNNGG 1 cut(s) 190
BshFI GGCC 2 cut(s) 116, 251
BslI CCNNNNNNNGG 1 cut(s) 190
BsmAI GTCTC 1 cut(s) 153
BsnI GGCC 2 cut(s) 116, 251
Bsp143I GATC 3 cut(s) 123, 369, 381
BspANI GGCC 2 cut(s) 116, 251
BspPI GGATC 1 cut(s) 389
BssMI GATC 3 cut(s) 123, 369, 381
Bst2UI CCWGG 1 cut(s) 164
BstKTI GATC 3 cut(s) 126, 372, 384
BstMAI GTCTC 1 cut(s) 153
BstMBI GATC 3 cut(s) 123, 369, 381
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstNI CCWGG 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 162
BstV2I GAAGAC 2 cut(s) 212, 340
BstX2I RGATCY 1 cut(s) 381
BstYI RGATCY 1 cut(s) 381
BsuRI GGCC 2 cut(s) 116, 251
BtrI CACGTC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 1 cut(s) 357
CviAII CATG 2 cut(s) 142, 190
CviJI RGCY 5 cut(s) 55, 116, 251, 269, 396
CviKI_1 RGCY 5 cut(s) 55, 116, 251, 269, 396
CviQI GTAC 1 cut(s) 357
DpnI GATC 3 cut(s) 125, 371, 383
DpnII GATC 3 cut(s) 123, 369, 381
Eco147I AGGCCT 1 cut(s) 251
Eco47I GGWCC 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 162
FaeI CATG 2 cut(s) 145, 193
FaiI YATR 4 cut(s) 86, 143, 191, 350
FatI CATG 2 cut(s) 141, 189
FblI GTMKAC 1 cut(s) 168
HaeIII GGCC 2 cut(s) 116, 251
Hin1II CATG 2 cut(s) 145, 193
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HindIII AAGCTT 1 cut(s) 53
HinfI GANTC 2 cut(s) 146, 159
HphI GGTGA 2 cut(s) 67, 250
Hpy166II GTNNAC 3 cut(s) 31, 169, 178
Hpy188I TCNGA 4 cut(s) 60, 238, 305, 369
Hpy8I GTNNAC 3 cut(s) 31, 169, 178
HpyAV CCTTC 2 cut(s) 12, 241
HpyCH4IV ACGT 2 cut(s) 138, 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
HpySE526I ACGT 2 cut(s) 138, 255
Hsp92II CATG 2 cut(s) 145, 193
Kzo9I GATC 3 cut(s) 123, 369, 381
LpnPI CCDG 3 cut(s) 91, 149, 176
LweI GCATC 2 cut(s) 51, 90
MaeII ACGT 2 cut(s) 138, 255
MaeIII GTNAC 1 cut(s) 256
MalI GATC 3 cut(s) 125, 371, 383
MboI GATC 3 cut(s) 123, 369, 381
MboII GAAGA 5 cut(s) 212, 214, 217, 342, 345
MfeI CAATTG 1 cut(s) 389
MflI RGATCY 1 cut(s) 381
MluCI AATT 2 cut(s) 90, 389
MlyI GAGTC 1 cut(s) 155
MmeI TCCRAC 1 cut(s) 337
MnlI CCTC 6 cut(s) 15, 127, 187, 194, 272, 302
MspR9I CCNGG 1 cut(s) 164
MunI CAATTG 1 cut(s) 389
MvaI CCWGG 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 3 cut(s) 123, 369, 381
NlaIII CATG 2 cut(s) 145, 193
NmuCI GTSAC 1 cut(s) 256
PceI AGGCCT 1 cut(s) 251
PcsI WCGNNNNNNNCGW 1 cut(s) 234
PfeI GAWTC 1 cut(s) 159
PflFI GACNNNGTC 1 cut(s) 173
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
PspPI GGNCC 1 cut(s) 175
PsuI RGATCY 1 cut(s) 381
PsyI GACNNNGTC 1 cut(s) 173
RsaI GTAC 1 cut(s) 358
RsaNI GTAC 1 cut(s) 357
SalI GTCGAC 1 cut(s) 167
Sau3AI GATC 3 cut(s) 123, 369, 381
Sau96I GGNCC 1 cut(s) 175
SchI GAGTC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 164
SetI ASST 7 cut(s) 57, 141, 168, 177, 258, 294, 300
SfaNI GCATC 2 cut(s) 51, 90
SinI GGWCC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
Sse9I AATT 2 cut(s) 90, 389
SseBI AGGCCT 1 cut(s) 251
StuI AGGCCT 1 cut(s) 251
StyD4I CCNGG 1 cut(s) 162
TaiI ACGT 2 cut(s) 141, 258
TaqI TCGA 2 cut(s) 126, 168
TasI AATT 2 cut(s) 90, 389
TatI WGTACW 1 cut(s) 356
TfiI GAWTC 1 cut(s) 159
TseFI GTSAC 1 cut(s) 256
Tsp45I GTSAC 1 cut(s) 256
TspGWI ACGGA 1 cut(s) 171
Tth111I GACNNNGTC 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 175
XmiI GTMKAC 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.