MD07G1000700.v1.1

Vacuolar protein sorting-associated protein 62

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0010762
Physical Location & Seq
Reverse (-)
118777 .. 119286
510 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1000700.v1.1.491

Sequence Viewer

Length: 213 bp
ATGGGAAATTACCTTTCCCTCTCACCTTCAGCAACAAGTGTTTTCAAGGAAACCCAAGCTTTGCCTATCGAAACCACGTTCAAGCTTCCCTCTCCATTACCTAGCTGGCCTCCTGGTGATGGGTTCACAAGTGGAATGATCGATCTGGGAGGATTACTAGTGTGTCAGATATCGTCTTTCAACAAAGTTTGGGCTACTCATGAGGGGGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Vps62

Protein Analysis

71

Amino Acids

7.41

Weight (kDa)

4.9

Isoelectric Point (pI)

47.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vps62 PF06101 24 - 69 3.5e-14 Vacuolar protein sorting-associated protein 62
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010762)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G04350 AT3G04350
fragaria_vesca FvH4_6g01580
malus_domestica MD00G1149300.v1.1 MD04G1232300.v1.1 MD07G1000700.v1.1
prunus_persica Prupe.2G000800_v2.0.a1 Prupe.6G351900_v2.0.a1
pyrus_communis pycom04g20570 pycom12g23000
rosa_chinensis RchiOBHm_Chr3g0449321
rosa_laevigata RLG00000025839
rosa_multiflora Rmu_sc0017357.1_g000003
rosa_roxburghii Rroxscaffold_6G00427330
rosa_rugosa Rorug02G0619700
rosa_samantha Rh3AG017700 Rh3BG017800 Rh3CG016800
rosa_wichuraiana Rw3G001360 Rw3G001390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 3 cut(s) 46, 82, 181
AhlI ACTAGT 1 cut(s) 157
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 3 cut(s) 59, 85, 105
AluI AGCT 3 cut(s) 59, 85, 105
AoxI GGCC 1 cut(s) 107
AsuHPI GGTGA 2 cut(s) 15, 128
BccI CCATC 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 114
BcuI ACTAGT 1 cut(s) 157
BfaI CTAG 2 cut(s) 102, 158
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
Bsa29I ATCGAT 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 114
BseCI ATCGAT 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 119
BshFI GGCC 1 cut(s) 109
BshVI ATCGAT 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 119
BsnI GGCC 1 cut(s) 109
Bsp143I GATC 2 cut(s) 138, 142
BspANI GGCC 1 cut(s) 109
BspDI ATCGAT 1 cut(s) 141
BspHI TCATGA 1 cut(s) 199
BssMI GATC 2 cut(s) 138, 142
Bst2UI CCWGG 1 cut(s) 114
BstC8I GCNNGC 1 cut(s) 107
BstKTI GATC 2 cut(s) 141, 145
BstMBI GATC 2 cut(s) 138, 142
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
Bsu15I ATCGAT 1 cut(s) 141
BsuRI GGCC 1 cut(s) 109
BsuTUI ATCGAT 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 107
CciI TCATGA 1 cut(s) 199
ClaI ATCGAT 1 cut(s) 141
CviAII CATG 1 cut(s) 200
CviJI RGCY 5 cut(s) 59, 85, 105, 109, 194
CviKI_1 RGCY 5 cut(s) 59, 85, 105, 109, 194
DpnI GATC 2 cut(s) 140, 144
DpnII GATC 2 cut(s) 138, 142
Eco32I GATATC 1 cut(s) 171
Eco57I CTGAAG 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 112
EcoRV GATATC 1 cut(s) 171
FaeI CATG 1 cut(s) 203
FaiI YATR 1 cut(s) 201
FatI CATG 1 cut(s) 199
FspBI CTAG 2 cut(s) 102, 158
HaeIII GGCC 1 cut(s) 109
Hin1II CATG 1 cut(s) 203
HindIII AAGCTT 2 cut(s) 57, 83
HphI GGTGA 2 cut(s) 15, 128
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 36
HpyCH4IV ACGT 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 77
Hsp92II CATG 1 cut(s) 203
Kzo9I GATC 2 cut(s) 138, 142
LpnPI CCDG 4 cut(s) 91, 99, 126, 131
MaeI CTAG 2 cut(s) 102, 158
MaeII ACGT 1 cut(s) 77
MalI GATC 2 cut(s) 140, 144
MboI GATC 2 cut(s) 138, 142
MluCI AATT 1 cut(s) 7
MnlI CCTC 5 cut(s) 29, 100, 120, 143, 196
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 2 cut(s) 138, 142
NlaIII CATG 1 cut(s) 203
PagI TCATGA 1 cut(s) 199
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
Sau3AI GATC 2 cut(s) 138, 142
ScrFI CCNGG 1 cut(s) 114
SetI ASST 7 cut(s) 15, 28, 61, 80, 87, 103, 107
SpeI ACTAGT 1 cut(s) 157
Sse9I AATT 1 cut(s) 7
SspMI CTAG 2 cut(s) 102, 158
StyD4I CCNGG 1 cut(s) 112
TaiI ACGT 1 cut(s) 80
TaqI TCGA 2 cut(s) 69, 141
TasI AATT 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 1 cut(s) 102
XspI CTAG 2 cut(s) 102, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.