Prupe.2G000800_v2.0.a1

Vacuolar protein sorting-associated protein 62

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
197771 .. 199481
1711 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G000800.1

Sequence Viewer

Length: 198 bp
ATGGGAAATTGCGCTGCCCTCTCAAATTCGGCAAGGGGTGTTTTCAATAAAAGCAAGGCTTCACCTTCTCCTATCGAAACCACATTCAAGCTTCAGGCTCCATTACCCAGCTGGCCACCTGGTGATGGGTTCGATCTAGGTGGATTACAAGTATCCCAGATATCATCTTTCAGTAAAGTTTGGGCTACCCAGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

6.84

Weight (kDa)

7.92

Isoelectric Point (pI)

60.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010762)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 113
AcsI RAATTY 1 cut(s) 25
AcuI CTGAAG 1 cut(s) 77
AdeI CACNNNGTG 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 46, 88
AjnI CCWGG 2 cut(s) 118, 189
AluBI AGCT 2 cut(s) 91, 111
AluI AGCT 2 cut(s) 91, 111
AoxI GGCC 1 cut(s) 113
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 1 cut(s) 25
AspLEI GCGC 1 cut(s) 14
AsuHPI GGTGA 2 cut(s) 54, 134
BalI TGGCCA 1 cut(s) 115
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 2 cut(s) 120, 191
BciVI GTATCC 1 cut(s) 163
BfaI CTAG 1 cut(s) 137
BfuI GTATCC 1 cut(s) 163
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bme1390I CCNGG 2 cut(s) 120, 191
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 2 cut(s) 120, 191
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseBI CCWGG 2 cut(s) 120, 191
BseDI CCNNGG 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 125
BseYI CCCAGC 1 cut(s) 107
BshFI GGCC 1 cut(s) 115
BslI CCNNNNNNNGG 1 cut(s) 125
BsnI GGCC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 133
BspANI GGCC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 1 cut(s) 133
Bst2UI CCWGG 2 cut(s) 120, 191
BstC8I GCNNGC 1 cut(s) 113
BstHHI GCGC 1 cut(s) 14
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstNI CCWGG 2 cut(s) 120, 191
BstSCI CCNGG 2 cut(s) 118, 189
BsuI GTATCC 1 cut(s) 163
BsuRI GGCC 1 cut(s) 115
Cac8I GCNNGC 1 cut(s) 113
CfoI GCGC 1 cut(s) 14
CsiI ACCWGGT 1 cut(s) 118
CviJI RGCY 6 cut(s) 59, 91, 98, 111, 115, 185
CviKI_1 RGCY 6 cut(s) 59, 91, 98, 111, 115, 185
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DraIII CACNNNGTG 1 cut(s) 122
EaeI YGGCCR 1 cut(s) 113
Eco32I GATATC 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 77
EcoRII CCWGG 2 cut(s) 118, 189
EcoRV GATATC 1 cut(s) 162
FalI AAGNNNNNCTT 2 cut(s) 43, 75
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 137
GlaI GCGC 1 cut(s) 13
GluI GCNGC 1 cut(s) 15
GsaI CCCAGC 1 cut(s) 111
HaeIII GGCC 1 cut(s) 115
HhaI GCGC 1 cut(s) 14
Hin6I GCGC 1 cut(s) 12
HinP1I GCGC 1 cut(s) 12
HindIII AAGCTT 1 cut(s) 89
HphI GGTGA 2 cut(s) 54, 134
HpyAV CCTTC 1 cut(s) 75
HspAI GCGC 1 cut(s) 12
Kzo9I GATC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 7 cut(s) 80, 97, 105, 121, 132, 170, 176
MabI ACCWGGT 1 cut(s) 118
MaeI CTAG 1 cut(s) 137
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MlsI TGGCCA 1 cut(s) 115
MluCI AATT 2 cut(s) 7, 25
MluNI TGGCCA 1 cut(s) 115
MnlI CCTC 1 cut(s) 29
Mox20I TGGCCA 1 cut(s) 115
MscI TGGCCA 1 cut(s) 115
Msp20I TGGCCA 1 cut(s) 115
MspA1I CMGCKG 1 cut(s) 111
MspR9I CCNGG 2 cut(s) 120, 191
MvaI CCWGG 2 cut(s) 120, 191
NdeII GATC 1 cut(s) 133
NlaIV GGNNCC 1 cut(s) 99
PkrI GCNGC 1 cut(s) 16
Psp6I CCWGG 2 cut(s) 118, 189
PspFI CCCAGC 1 cut(s) 107
PspGI CCWGG 2 cut(s) 118, 189
PspN4I GGNNCC 1 cut(s) 99
PvuII CAGCTG 1 cut(s) 111
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 1 cut(s) 133
ScrFI CCNGG 2 cut(s) 120, 191
SetI ASST 5 cut(s) 67, 93, 113, 121, 142
SexAI ACCWGGT 1 cut(s) 118
Sse9I AATT 2 cut(s) 7, 25
SspMI CTAG 1 cut(s) 137
StyD4I CCNGG 2 cut(s) 118, 189
TaqI TCGA 2 cut(s) 75, 132
TasI AATT 2 cut(s) 7, 25
TseI GCWGC 1 cut(s) 14
XapI RAATTY 1 cut(s) 25
XcmI CCANNNNNNNNNTGG 1 cut(s) 108
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.