MD07G1230200.v1.1

Hypoxia induced protein conserved region

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
30478365 .. 30479138
774 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1230200.v1.1.491

Sequence Viewer

Length: 243 bp
ATGGAGGCAATTCAGTCTTGGGTTTCAGAACACAAGCTTACAAGCATTGGAGGAATATGGGCATCGGCAGTTGGAGCATCTCTAGCCTATTCACGAGCAAGAACACCCCTCAAGCCAAGCCTTAGGCTTATACATGCTAGGATGCACGCACAGGCCTTGACCCTGGCTGTCCTATCTGGTGCAGCAGTCTACCATTACTATGTGGACCATGAAGCAGCTGCCCACCACGATGGAGAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.66

Weight (kDa)

7.06

Isoelectric Point (pI)

30.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HIG_1_N PF04588 10 - 60 8.7e-11 Hypoxia induced protein conserved region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015905)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G27760 AT5G27760
fragaria_vesca FvH4_7g25530
malus_domestica MD01G1162000.v1.1 MD07G1230200.v1.1
prunus_persica Prupe.2G260100_v2.0.a1
pyrus_communis pycom01g17750
rosa_chinensis RchiOBHm_Chr1g0371531
rosa_multiflora Rmu_sc0000809.1_g000015
rosa_rugosa Rorug01G0365100
rosa_samantha Rh1AG375000 Rh1BG338500 Rh1CG351800 Rh1DG369500
rosa_wichuraiana Rw1G032990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 189
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 2 cut(s) 37, 218
AluI AGCT 2 cut(s) 37, 218
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 3 cut(s) 182, 215, 218
AspS9I GGNCC 1 cut(s) 205
AvaII GGWCC 1 cut(s) 205
AxyI CCTNAGG 1 cut(s) 122
BauI CACGAG 1 cut(s) 93
BbvI GCAGC 3 cut(s) 194, 205, 227
BccI CCATC 1 cut(s) 224
BciT130I CCWGG 1 cut(s) 164
BfaI CTAG 2 cut(s) 83, 138
BisI GCNGC 3 cut(s) 183, 216, 219
BlsI GCNGC 3 cut(s) 184, 217, 220
Bme1390I CCNGG 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
BmrFI CCNGG 1 cut(s) 164
BmsI GCATC 3 cut(s) 71, 86, 132
BpuEI CTTGAG 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 162
Bse21I CCTNAGG 1 cut(s) 122
BseBI CCWGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 147
BseXI GCAGC 3 cut(s) 194, 205, 227
BsgI GTGCAG 1 cut(s) 201
BshFI GGCC 1 cut(s) 155
BsnI GGCC 1 cut(s) 155
BspANI GGCC 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 162
BssSI CACGAG 1 cut(s) 93
Bst2BI CACGAG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 122
BstF5I GGATG 1 cut(s) 147
BstMWI GCNNNNNNNGC 2 cut(s) 74, 83
BstNI CCWGG 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 162
BstV1I GCAGC 3 cut(s) 194, 205, 227
BstXI CCANNNNNNTGG 1 cut(s) 230
Bsu36I CCTNAGG 1 cut(s) 122
BsuRI GGCC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 205
CviAII CATG 2 cut(s) 134, 209
CviJI RGCY 8 cut(s) 37, 86, 115, 120, 127, 155, 167, 218
CviKI_1 RGCY 8 cut(s) 37, 86, 115, 120, 127, 155, 167, 218
DdeI CTNAG 1 cut(s) 122
Eco147I AGGCCT 1 cut(s) 155
Eco47I GGWCC 1 cut(s) 205
Eco81I CCTNAGG 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 162
FaeI CATG 2 cut(s) 137, 212
FaiI YATR 5 cut(s) 58, 131, 135, 201, 210
FatI CATG 2 cut(s) 133, 208
FblI GTMKAC 1 cut(s) 189
Fnu4HI GCNGC 3 cut(s) 183, 216, 219
FokI GGATG 1 cut(s) 154
Fsp4HI GCNGC 3 cut(s) 183, 216, 219
FspBI CTAG 2 cut(s) 83, 138
GluI GCNGC 3 cut(s) 183, 216, 219
HaeIII GGCC 1 cut(s) 155
Hin1II CATG 2 cut(s) 137, 212
HindIII AAGCTT 1 cut(s) 35
Hpy166II GTNNAC 2 cut(s) 190, 205
Hpy188I TCNGA 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 93
Hpy8I GTNNAC 2 cut(s) 190, 205
HpyCH4V TGCA 2 cut(s) 145, 182
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 83
HpyF3I CTNAG 1 cut(s) 122
Hsp92II CATG 2 cut(s) 137, 212
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 4 cut(s) 137, 149, 162, 176
Lsp1109I GCAGC 3 cut(s) 194, 205, 227
LweI GCATC 3 cut(s) 71, 86, 132
MaeI CTAG 2 cut(s) 83, 138
MluCI AATT 1 cut(s) 9
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 2 cut(s) 44, 119
MslI CAYNNNNRTG 2 cut(s) 198, 228
MspA1I CMGCKG 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 164
MvaI CCWGG 1 cut(s) 164
MwoI GCNNNNNNNGC 2 cut(s) 74, 83
NlaIII CATG 2 cut(s) 137, 212
NspI RCATGY 1 cut(s) 137
PceI AGGCCT 1 cut(s) 155
PkrI GCNGC 3 cut(s) 184, 217, 220
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
PspPI GGNCC 1 cut(s) 205
PvuII CAGCTG 1 cut(s) 218
RseI CAYNNNNRTG 2 cut(s) 198, 228
SatI GCNGC 3 cut(s) 183, 216, 219
Sau96I GGNCC 1 cut(s) 205
ScrFI CCNGG 1 cut(s) 164
SetI ASST 2 cut(s) 39, 220
SfaNI GCATC 3 cut(s) 71, 86, 132
SinI GGWCC 1 cut(s) 205
SmiMI CAYNNNNRTG 2 cut(s) 198, 228
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 1 cut(s) 9
SseBI AGGCCT 1 cut(s) 155
SspMI CTAG 2 cut(s) 83, 138
StuI AGGCCT 1 cut(s) 155
StyD4I CCNGG 1 cut(s) 162
TasI AATT 1 cut(s) 9
TseI GCWGC 3 cut(s) 182, 215, 218
TspDTI ATGAA 1 cut(s) 225
VpaK11BI GGWCC 1 cut(s) 205
XceI RCATGY 1 cut(s) 137
XmiI GTMKAC 1 cut(s) 189
XspI CTAG 2 cut(s) 83, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.