Rmu_sc0000809.1_g000015

Hypoxia induced protein conserved region

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000809.1
Physical Location & Seq
Forward (+)
66840 .. 67572
733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000809.1_g000015.1.cds

Sequence Viewer

Length: 237 bp
atggagtcaattcagtcttgggtttcaaagaacaagctggccagcattggaggactatgggcatcaggagttgtagcatcccttgcttattcaactgcaagaacacctctcaagaccagccttaagcttatacatgctaggatgcacgcacaagccttgacgctgggtgtcctatccgccgcggcagtcttccactactatgaggaagcacacagtgctgctgcttctccaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.24

Weight (kDa)

9.6

Isoelectric Point (pI)

42.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015905)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G27760 AT5G27760
fragaria_vesca FvH4_7g25530
malus_domestica MD01G1162000.v1.1 MD07G1230200.v1.1
prunus_persica Prupe.2G260100_v2.0.a1
pyrus_communis pycom01g17750
rosa_chinensis RchiOBHm_Chr1g0371531
rosa_multiflora Rmu_sc0000809.1_g000015
rosa_rugosa Rorug01G0365100
rosa_samantha Rh1AG375000 Rh1BG338500 Rh1CG351800 Rh1DG369500
rosa_wichuraiana Rw1G032990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 182
AciI CCGC 3 cut(s) 177, 180, 182
AcoI YGGCCR 1 cut(s) 39
AdeI CACNNNGTG 1 cut(s) 215
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 2 cut(s) 27, 93
AluBI AGCT 2 cut(s) 37, 127
AluI AGCT 2 cut(s) 37, 127
AoxI GGCC 1 cut(s) 39
ApeKI GCWGC 2 cut(s) 218, 221
BalI TGGCCA 1 cut(s) 41
BbsI GAAGAC 1 cut(s) 181
BbvI GCAGC 2 cut(s) 205, 208
BfaI CTAG 1 cut(s) 138
BfrI CTTAAG 1 cut(s) 122
BisI GCNGC 4 cut(s) 180, 183, 219, 222
BlsI GCNGC 4 cut(s) 181, 184, 220, 223
BmsI GCATC 3 cut(s) 71, 86, 132
BpiI GAAGAC 1 cut(s) 181
BpuEI CTTGAG 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 2 cut(s) 77, 147
BseXI GCAGC 2 cut(s) 205, 208
BseYI CCCAGC 1 cut(s) 163
Bsh1236I CGCG 1 cut(s) 182
BshFI GGCC 1 cut(s) 41
BsnI GGCC 1 cut(s) 41
BspACI CCGC 3 cut(s) 177, 180, 182
BspANI GGCC 1 cut(s) 41
BspFNI CGCG 1 cut(s) 182
BspTI CTTAAG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 215
BstAFI CTTAAG 1 cut(s) 122
BstAPI GCANNNNNTGC 2 cut(s) 83, 215
BstC8I GCNNGC 3 cut(s) 39, 43, 147
BstDSI CCRYGG 1 cut(s) 180
BstF5I GGATG 2 cut(s) 77, 147
BstFNI CGCG 1 cut(s) 182
BstMWI GCNNNNNNNGC 2 cut(s) 83, 215
BstNSI RCATGY 1 cut(s) 137
BstUI CGCG 1 cut(s) 182
BstV1I GCAGC 2 cut(s) 205, 208
BstV2I GAAGAC 1 cut(s) 181
BsuRI GGCC 1 cut(s) 41
BtgI CCRYGG 1 cut(s) 180
BtsCI GGATG 2 cut(s) 77, 147
BtsIMutI CAGTG 1 cut(s) 220
Cac8I GCNNGC 3 cut(s) 39, 43, 147
Cfr42I CCGCGG 1 cut(s) 183
CseI GACGC 1 cut(s) 169
CviAII CATG 1 cut(s) 134
CviJI RGCY 5 cut(s) 37, 41, 120, 127, 155
CviKI_1 RGCY 5 cut(s) 37, 41, 120, 127, 155
DraIII CACNNNGTG 1 cut(s) 215
EaeI YGGCCR 1 cut(s) 39
EciI GGCGGA 1 cut(s) 166
FaeI CATG 1 cut(s) 137
FaiI YATR 4 cut(s) 58, 131, 135, 201
FatI CATG 1 cut(s) 133
Fnu4HI GCNGC 4 cut(s) 180, 183, 219, 222
FokI GGATG 2 cut(s) 64, 154
Fsp4HI GCNGC 4 cut(s) 180, 183, 219, 222
FspBI CTAG 1 cut(s) 138
GluI GCNGC 4 cut(s) 180, 183, 219, 222
GsaI CCCAGC 1 cut(s) 167
HaeIII GGCC 1 cut(s) 41
HgaI GACGC 1 cut(s) 169
Hin1II CATG 1 cut(s) 137
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 2 cut(s) 66, 112
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 98, 145
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 215
Hsp92II CATG 1 cut(s) 137
KspI CCGCGG 1 cut(s) 183
LpnPI CCDG 5 cut(s) 23, 51, 55, 130, 149
Lsp1109I GCAGC 2 cut(s) 205, 208
LweI GCATC 3 cut(s) 71, 86, 132
MaeI CTAG 1 cut(s) 138
MboII GAAGA 1 cut(s) 181
MlsI TGGCCA 1 cut(s) 41
MluCI AATT 2 cut(s) 9, 232
MluNI TGGCCA 1 cut(s) 41
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 3 cut(s) 44, 117, 196
Mox20I TGGCCA 1 cut(s) 41
MscI TGGCCA 1 cut(s) 41
MseI TTAA 2 cut(s) 123, 235
MslI CAYNNNNRTG 1 cut(s) 198
Msp20I TGGCCA 1 cut(s) 41
MspA1I CMGCKG 1 cut(s) 182
MspCI CTTAAG 1 cut(s) 122
MvnI CGCG 1 cut(s) 182
MwoI GCNNNNNNNGC 2 cut(s) 83, 215
NlaIII CATG 1 cut(s) 137
NspI RCATGY 1 cut(s) 137
PkrI GCNGC 4 cut(s) 181, 184, 220, 223
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PspFI CCCAGC 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 198
SacII CCGCGG 1 cut(s) 183
SaqAI TTAA 2 cut(s) 123, 235
SatI GCNGC 4 cut(s) 180, 183, 219, 222
SchI GAGTC 1 cut(s) 14
SetI ASST 3 cut(s) 39, 109, 129
SfaNI GCATC 3 cut(s) 71, 86, 132
Sfr303I CCGCGG 1 cut(s) 183
SgrBI CCGCGG 1 cut(s) 183
SmiMI CAYNNNNRTG 1 cut(s) 198
SmlI CTYRAG 2 cut(s) 110, 122
SmoI CTYRAG 2 cut(s) 110, 122
Sse9I AATT 2 cut(s) 9, 232
SsiI CCGC 3 cut(s) 177, 180, 182
SspMI CTAG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 215
TasI AATT 2 cut(s) 9, 232
TauI GCSGC 2 cut(s) 182, 185
Tru1I TTAA 2 cut(s) 123, 235
Tru9I TTAA 2 cut(s) 123, 235
TscAI CASTG 1 cut(s) 220
TseI GCWGC 2 cut(s) 218, 221
TspRI CASTG 1 cut(s) 220
Vha464I CTTAAG 1 cut(s) 122
XceI RCATGY 1 cut(s) 137
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.