Rorug01G0365100

Hypoxia induced protein conserved region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004090
Physical Location & Seq
Forward (+)
48002774 .. 48004448
1675 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0365100.1

Sequence Viewer

Length: 444 bp
ATGGCCTTTATGCTTTCGCCTGGGGTCTCGCGAATCGTTACTATTGTATTGAGGGTCCTGACTGCCATTGTTCTGTTTGTATCACTCGTGATGCTCGTAACCAATAATCAGGATTATCAAGACCCTAATGACAACGGAAACACTAAAACCGCTCGTTTTTATGATCAAGTTGGATTCCAATACATGGCTGCCACAACAGTTCTCGGAATTGGGTTTTCAATCTATGGAACCGTAATTGTAGCTTTGCGCATCAAGAGAGGAAATGATGAAGGGAACCTGTTGATTGATTTCTATGGCCAGAAGGATTTCTTACTGTCCAAGCTGTGGATAAAGCTCTCTCTGATCACTTTGGCACGTTCGCGGAGCTGGCCACTAACGGCTATTATTGGGGTTTGTATAAGACATGTTCTGGACTTGTCCTCCTTGGCTTCTTCTTGTCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HIG_1_N

Protein Analysis

147

Amino Acids

16.28

Weight (kDa)

9.3

Isoelectric Point (pI)

32.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CASP_dom PF04535 11 - 92 2.4e-08 Casparian strip membrane protein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 248
AccB7I CCANNNNNTGG 2 cut(s) 184, 324
AccBSI CCGCTC 1 cut(s) 152
AccII CGCG 2 cut(s) 31, 361
AciI CCGC 2 cut(s) 150, 361
AcoI YGGCCR 2 cut(s) 295, 368
AfiI CCNNNNNNNGG 2 cut(s) 184, 324
AflIII ACRYGT 1 cut(s) 403
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 4 cut(s) 242, 322, 334, 366
AluI AGCT 4 cut(s) 242, 322, 334, 366
Alw26I GTCTC 1 cut(s) 31
AoxI GGCC 3 cut(s) 3, 295, 368
ApeKI GCWGC 1 cut(s) 188
Asp700I GAANNNNTTC 1 cut(s) 305
AspLEI GCGC 1 cut(s) 249
AspS9I GGNCC 1 cut(s) 55
AvaII GGWCC 1 cut(s) 55
BalI TGGCCA 2 cut(s) 297, 370
BauI CACGAG 1 cut(s) 86
BbvI GCAGC 1 cut(s) 175
BceAI ACGGC 1 cut(s) 393
BciT130I CCWGG 1 cut(s) 21
BclI TGATCA 2 cut(s) 163, 342
BcoDI GTCTC 1 cut(s) 31
BfmI CTRYAG 1 cut(s) 440
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme1390I CCNGG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 55
BmiI GGNNCC 3 cut(s) 56, 229, 275
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 2 cut(s) 81, 258
BsaI GGTCTC 1 cut(s) 31
BsaJI CCNNGG 2 cut(s) 20, 423
BsaXI ACNNNNNCTCC 2 cut(s) 404, 434
Bsc4I CCNNNNNNNGG 2 cut(s) 184, 324
BseBI CCWGG 1 cut(s) 21
BseDI CCNNGG 2 cut(s) 20, 423
BseLI CCNNNNNNNGG 2 cut(s) 184, 324
BseXI GCAGC 1 cut(s) 175
Bsh1236I CGCG 2 cut(s) 31, 361
BshFI GGCC 3 cut(s) 5, 297, 370
BslI CCNNNNNNNGG 2 cut(s) 184, 324
BsmAI GTCTC 1 cut(s) 31
BsnI GGCC 3 cut(s) 5, 297, 370
Bso31I GGTCTC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 163, 342
Bsp68I TCGCGA 1 cut(s) 31
BspACI CCGC 2 cut(s) 150, 361
BspANI GGCC 3 cut(s) 5, 297, 370
BspFNI CGCG 2 cut(s) 31, 361
BspLI GGNNCC 3 cut(s) 56, 229, 275
BspTNI GGTCTC 1 cut(s) 31
BsrBI CCGCTC 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 20, 423
BssMI GATC 2 cut(s) 163, 342
BssSI CACGAG 1 cut(s) 86
BssT1I CCWWGG 1 cut(s) 423
Bst2BI CACGAG 1 cut(s) 86
Bst2UI CCWGG 1 cut(s) 21
Bst4CI ACNGT 3 cut(s) 199, 232, 315
BstC8I GCNNGC 1 cut(s) 368
BstFNI CGCG 2 cut(s) 31, 361
BstHHI GCGC 1 cut(s) 249
BstKTI GATC 2 cut(s) 166, 345
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 2 cut(s) 163, 342
BstMWI GCNNNNNNNGC 1 cut(s) 367
BstNI CCWGG 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 407
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 440
BstUI CGCG 2 cut(s) 31, 361
BstV1I GCAGC 1 cut(s) 175
BsuRI GGCC 3 cut(s) 5, 297, 370
BtuMI TCGCGA 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 368
CfoI GCGC 1 cut(s) 249
Cfr13I GGNCC 1 cut(s) 55
CviAII CATG 2 cut(s) 184, 404
DpnI GATC 2 cut(s) 165, 344
DpnII GATC 2 cut(s) 163, 342
EaeI YGGCCR 2 cut(s) 295, 368
Eco130I CCWWGG 1 cut(s) 423
Eco31I GGTCTC 1 cut(s) 31
Eco47I GGWCC 1 cut(s) 55
EcoO109I RGGNCCY 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 423
ErhI CCWWGG 1 cut(s) 423
FaeI CATG 2 cut(s) 187, 407
FaiI YATR 7 cut(s) 11, 162, 185, 225, 294, 398, 405
FalI AAGNNNNNCTT 2 cut(s) 293, 325
FatI CATG 2 cut(s) 183, 403
FbaI TGATCA 2 cut(s) 163, 342
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
FspI TGCGCA 1 cut(s) 248
GlaI GCGC 1 cut(s) 248
GluI GCNGC 1 cut(s) 189
HaeIII GGCC 3 cut(s) 5, 297, 370
HhaI GCGC 1 cut(s) 249
Hin1II CATG 2 cut(s) 187, 407
Hin6I GCGC 1 cut(s) 247
HinP1I GCGC 1 cut(s) 247
HinfI GANTC 2 cut(s) 33, 174
Hpy188I TCNGA 2 cut(s) 206, 342
Hpy188III TCNNGA 7 cut(s) 30, 58, 88, 110, 119, 253, 410
HpyAV CCTTC 2 cut(s) 263, 295
HpyCH4III ACNGT 3 cut(s) 199, 232, 315
HpyCH4IV ACGT 1 cut(s) 355
HpyF10VI GCNNNNNNNGC 1 cut(s) 367
HpySE526I ACGT 1 cut(s) 355
Hsp92II CATG 2 cut(s) 187, 407
HspAI GCGC 1 cut(s) 247
Ksp22I TGATCA 2 cut(s) 163, 342
Kzo9I GATC 2 cut(s) 163, 342
LmnI GCTCC 1 cut(s) 363
LpnPI CCDG 8 cut(s) 6, 33, 71, 95, 290, 311, 352, 395
Lsp1109I GCAGC 1 cut(s) 175
LweI GCATC 2 cut(s) 81, 258
MaeII ACGT 1 cut(s) 355
MaeIII GTNAC 2 cut(s) 37, 97
MalI GATC 2 cut(s) 165, 344
MbiI CCGCTC 1 cut(s) 152
MboI GATC 2 cut(s) 163, 342
MboII GAAGA 1 cut(s) 423
MlsI TGGCCA 2 cut(s) 297, 370
MluCI AATT 2 cut(s) 207, 234
MluNI TGGCCA 2 cut(s) 297, 370
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 3 cut(s) 45, 251, 430
Mox20I TGGCCA 2 cut(s) 297, 370
MroXI GAANNNNTTC 1 cut(s) 305
MscI TGGCCA 2 cut(s) 297, 370
Msp20I TGGCCA 2 cut(s) 297, 370
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MvnI CGCG 2 cut(s) 31, 361
MwoI GCNNNNNNNGC 1 cut(s) 367
NdeII GATC 2 cut(s) 163, 342
NlaIII CATG 2 cut(s) 187, 407
NlaIV GGNNCC 3 cut(s) 56, 229, 275
NruI TCGCGA 1 cut(s) 31
NsbI TGCGCA 1 cut(s) 248
NspI RCATGY 1 cut(s) 407
PciI ACATGT 1 cut(s) 403
PcsI WCGNNNNNNNCGW 1 cut(s) 93
PdmI GAANNNNTTC 1 cut(s) 305
PfeI GAWTC 2 cut(s) 33, 174
PflMI CCANNNNNTGG 2 cut(s) 184, 324
PkrI GCNGC 1 cut(s) 190
PpuMI RGGWCCY 1 cut(s) 55
PscI ACATGT 1 cut(s) 403
Psp5II RGGWCCY 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 3 cut(s) 56, 229, 275
PspPI GGNCC 1 cut(s) 55
PspPPI RGGWCCY 1 cut(s) 55
RruI TCGCGA 1 cut(s) 31
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 2 cut(s) 163, 342
Sau96I GGNCC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 21
SetI ASST 6 cut(s) 244, 279, 324, 336, 358, 368
SfaNI GCATC 2 cut(s) 81, 258
SfcI CTRYAG 1 cut(s) 440
SinI GGWCC 1 cut(s) 55
Sse9I AATT 2 cut(s) 207, 234
SsiI CCGC 2 cut(s) 150, 361
StyD4I CCNGG 1 cut(s) 19
StyI CCWWGG 1 cut(s) 423
TaaI ACNGT 3 cut(s) 199, 232, 315
TaiI ACGT 1 cut(s) 358
TasI AATT 2 cut(s) 207, 234
TfiI GAWTC 2 cut(s) 33, 174
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 1 cut(s) 282
TspGWI ACGGA 1 cut(s) 150
Van91I CCANNNNNTGG 2 cut(s) 184, 324
VpaK11BI GGWCC 1 cut(s) 55
XceI RCATGY 1 cut(s) 407
XmnI GAANNNNTTC 1 cut(s) 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.