MD08G1060700.v1.1

ATP hydrolysis coupled proton transport

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
4825099 .. 4825284
186 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1060700.v1.1.491

Sequence Viewer

Length: 186 bp
ATGAAAGTGGATCAGTTTCGAATTATTGGATATTCTAAAATAGAACAAGAAAAATTGAATATGATTAATTCCACTTATAAGACTTTGGAACAATTAGAAAATTACAAAAACGAAACCATTCATTTTGAACAACAAAAGGCGATTAATCAAGTTAGACAACGGGTTTTTCAGCAAGCCTTACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006139 GO:0006163 GO:0006164 GO:0006725 GO:0006753 GO:0006754 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006811 GO:0006812 GO:0008150 GO:0008152 GO:0008324 GO:0009058 GO:0009117 GO:0009123 GO:0009124 GO:0009126 GO:0009127 GO:0009141 GO:0009142 GO:0009144 GO:0009145 GO:0009150 GO:0009152 GO:0009156 GO:0009161 GO:0009165 GO:0009167 GO:0009168 GO:0009199 GO:0009201 GO:0009205 GO:0009206 GO:0009259 GO:0009260 GO:0009507 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0009987 GO:0015075 GO:0015077 GO:0015078 GO:0015318 GO:0015399 GO:0015405 GO:0015672 GO:0015985 GO:0015986 GO:0016020 GO:0016462 GO:0016469 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0017144 GO:0018130 GO:0019438 GO:0019637 GO:0019693 GO:0019829 GO:0022804 GO:0022853 GO:0022857 GO:0022890 GO:0031976 GO:0031984 GO:0032991 GO:0033177 GO:0034220 GO:0034357 GO:0034641 GO:0034654 GO:0042623 GO:0042625 GO:0042626 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044237 GO:0044238 GO:0044249 GO:0044271 GO:0044281 GO:0044422 GO:0044424 GO:0044425 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0044769 GO:0045259 GO:0045263 GO:0046034 GO:0046390 GO:0046483 GO:0046933 GO:0051179 GO:0051234 GO:0055035 GO:0055085 GO:0055086 GO:0071704 GO:0072521 GO:0072522 GO:0090407 GO:0090662 GO:0098655 GO:0098660 GO:0098662 GO:0098796 GO:0099131 GO:0099132 GO:1901135 GO:1901137 GO:1901293 GO:1901360 GO:1901362 GO:1901564 GO:1901566 GO:1901576 GO:1902600

Protein Analysis

62

Amino Acids

7.43

Weight (kDa)

9.1

Isoelectric Point (pI)

33.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_B PF00430 11 - 61 1.3e-07 ATP synthase B/B' CF(0)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 78
AclWI GGATC 1 cut(s) 18
AgsI TTSAA 2 cut(s) 58, 128
AlwI GGATC 1 cut(s) 18
AseI ATTAAT 2 cut(s) 66, 144
Asp700I GAANNNNTTC 1 cut(s) 117
AsuII TTCGAA 1 cut(s) 19
Bpu14I TTCGAA 1 cut(s) 19
Bsp119I TTCGAA 1 cut(s) 19
Bsp143I GATC 1 cut(s) 10
BspPI GGATC 1 cut(s) 18
BspT104I TTCGAA 1 cut(s) 19
BssMI GATC 1 cut(s) 10
BstBI TTCGAA 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 174
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 174
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
FaiI YATR 2 cut(s) 62, 78
FspEI CC 7 cut(s) 12, 71, 85, 122, 130, 145, 146
Kzo9I GATC 1 cut(s) 10
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MluCI AATT 5 cut(s) 21, 53, 67, 92, 100
MroXI GAANNNNTTC 1 cut(s) 117
MseI TTAA 2 cut(s) 66, 144
NdeII GATC 1 cut(s) 10
NspV TTCGAA 1 cut(s) 19
PdmI GAANNNNTTC 1 cut(s) 117
PshBI ATTAAT 2 cut(s) 66, 144
PsiI TTATAA 1 cut(s) 78
SaqAI TTAA 2 cut(s) 66, 144
Sau3AI GATC 1 cut(s) 10
SfuI TTCGAA 1 cut(s) 19
SgeI CNNG 3 cut(s) 59, 161, 173
Sse9I AATT 5 cut(s) 21, 53, 67, 92, 100
TaqI TCGA 1 cut(s) 19
TasI AATT 5 cut(s) 21, 53, 67, 92, 100
Tru1I TTAA 2 cut(s) 66, 144
Tru9I TTAA 2 cut(s) 66, 144
TspDTI ATGAA 2 cut(s) 17, 110
VspI ATTAAT 2 cut(s) 66, 144
XmnI GAANNNNTTC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.