Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr08

Orthogroup ID

OG0003340

Physical Location & Seq

Genomic Coordinates Reverse (-)

7249873 .. 7250827

Gene Structure 955 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD08G1087600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

ATGGGAGGAGGCAACGGCCAGAAGTCGAAGATGGCTCGCCAGAGGAACATGGAGAAGCAAAAAAATGCTGCCAAAGGCAGCCAGCTTGAATCAAACAAGAAATCAATGACAATTCAGTGCAAGGTGTGTATGCAAGTATTCATATGCACGACGAGCGAGGTGAAGTGCAGGGAGCATGCAGAAGCAAAACATCCCAAATCTGATGTTTACACATGTTTCCCTCATCTTCAAAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

4F5 zf-met2

Protein Analysis

79

Amino Acids

8.79

Weight (kDa)

9.64

Isoelectric Point (pI)

39.11

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
SERF-like_N	PF04419	3 - 36	2.5e-06	Small EDRK-rich factor 1/2-like, N-terminal
zf-met2	PF12907	39 - 76	8.1e-21	Zinc-binding

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003340)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G23090
fragaria_vesca	FvH4_1g17240 FvH4_2g33310
malus_domestica	MD08G1087600.v1.1 MD15G1072500.v1.1 MD15G1293500.v1.1
prunus_persica	Prupe.1G425100_v2.0.a1 Prupe.6G224000_v2.0.a1 Prupe.6G224000_v2.0.a1 Prupe.6G224000_v2.0.a1 Prupe.8G140800_v2.0.a1
pyrus_communis	pycom02g14770 pycom15g06780
rosa_chinensis	RchiOBHm_Chr2g0107431 RchiOBHm_Chr6g0252981 RchiOBHm_Chr6g0309311
rosa_multiflora	Rmu_sc0002560.1_g000004 Rmu_sc0007504.1_g000005 Rmu_sc0015692.1_g000003 Rmu_sc0025013.1_g000004 Rmu_sc0029870.1_g000001
rosa_roxburghii	Rroxscaffold_2G00136350 Rroxscaffold_7G00159500 Rroxscaffold_7G00212250
rosa_rugosa	Rorug02G0143500 Rorug02G0143500 Rorug06G0370800 Rorug06G0370800 Rorug06G0370900
rosa_samantha	Rh2AG193700 Rh2CG198900 Rh6AG484300 Rh6BG493400 Rh6CG498400 Rh6DG484900
rosa_wichuraiana	Rw2G015340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	16
AflIII	ACRYGT	1 cut(s)	212
AgsI	TTSAA	2 cut(s)	89, 230
AluBI	AGCT	1 cut(s)	85
AluI	AGCT	1 cut(s)	85
AoxI	GGCC	1 cut(s)	16
ApeKI	GCWGC	2 cut(s)	68, 78
AsuHPI	GGTGA	1 cut(s)	172
BbvI	GCAGC	2 cut(s)	55, 90
BccI	CCATC	1 cut(s)	25
BceAI	ACGGC	1 cut(s)	31
BisI	GCNGC	2 cut(s)	69, 79
BlsI	GCNGC	2 cut(s)	70, 80
BseGI	GGATG	1 cut(s)	190
BseRI	GAGGAG	1 cut(s)	21
BseXI	GCAGC	2 cut(s)	55, 90
BsgI	GTGCAG	1 cut(s)	187
BshFI	GGCC	1 cut(s)	18
BsnI	GGCC	1 cut(s)	18
BspANI	GGCC	1 cut(s)	18
BstC8I	GCNNGC	3 cut(s)	37, 83, 177
BstF5I	GGATG	1 cut(s)	190
BstMWI	GCNNNNNNNGC	1 cut(s)	153
BstNSI	RCATGY	2 cut(s)	179, 216
BstV1I	GCAGC	2 cut(s)	55, 90
BsuRI	GGCC	1 cut(s)	18
BtsCI	GGATG	1 cut(s)	190
BtsIMutI	CAGTG	1 cut(s)	122
Cac8I	GCNNGC	3 cut(s)	37, 83, 177
CviAII	CATG	3 cut(s)	49, 176, 213
CviJI	RGCY	4 cut(s)	18, 35, 81, 85
CviKI_1	RGCY	4 cut(s)	18, 35, 81, 85
EaeI	YGGCCR	1 cut(s)	16
FaeI	CATG	3 cut(s)	52, 179, 216
FaiI	YATR	6 cut(s)	50, 131, 143, 145, 177, 214
FatI	CATG	3 cut(s)	48, 175, 212
FauNDI	CATATG	1 cut(s)	143
Fnu4HI	GCNGC	2 cut(s)	69, 79
FokI	GGATG	1 cut(s)	177
Fsp4HI	GCNGC	2 cut(s)	69, 79
GluI	GCNGC	2 cut(s)	69, 79
HaeIII	GGCC	1 cut(s)	18
Hin1II	CATG	3 cut(s)	52, 179, 216
HinfI	GANTC	1 cut(s)	89
HphI	GGTGA	1 cut(s)	172
Hpy166II	GTNNAC	1 cut(s)	208
Hpy188I	TCNGA	1 cut(s)	202
Hpy8I	GTNNAC	1 cut(s)	208
Hpy99I	CGWCG	1 cut(s)	154
HpyCH4V	TGCA	5 cut(s)	120, 133, 147, 168, 179
HpyF10VI	GCNNNNNNNGC	1 cut(s)	153
Hsp92II	CATG	3 cut(s)	52, 179, 216
LmnI	GCTCC	1 cut(s)	172
LpnPI	CCDG	4 cut(s)	32, 53, 95, 154
Lsp1109I	GCAGC	2 cut(s)	55, 90
MboII	GAAGA	2 cut(s)	40, 218
MluCI	AATT	1 cut(s)	111
MnlI	CCTC	3 cut(s)	36, 151, 231
MwoI	GCNNNNNNNGC	1 cut(s)	153
NdeI	CATATG	1 cut(s)	143
NlaIII	CATG	3 cut(s)	52, 179, 216
NspI	RCATGY	2 cut(s)	179, 216
PaeI	GCATGC	1 cut(s)	179
PciI	ACATGT	1 cut(s)	212
PfeI	GAWTC	1 cut(s)	89
PkrI	GCNGC	2 cut(s)	70, 80
PscI	ACATGT	1 cut(s)	212
SatI	GCNGC	2 cut(s)	69, 79
SetI	ASST	3 cut(s)	87, 126, 162
SphI	GCATGC	1 cut(s)	179
Sse9I	AATT	1 cut(s)	111
TaqI	TCGA	1 cut(s)	26
TasI	AATT	1 cut(s)	111
TfiI	GAWTC	1 cut(s)	89
TscAI	CASTG	1 cut(s)	122
TseI	GCWGC	2 cut(s)	68, 78
TspDTI	ATGAA	1 cut(s)	130
TspRI	CASTG	1 cut(s)	122
XceI	RCATGY	2 cut(s)	179, 216

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.