MD08G1114700.v1.1

Carotenoid 9,10(9',10')-cleavage dioxygenase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0013626
Physical Location & Seq
Forward (+)
10358259 .. 10358942
684 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1114700.v1.1.491

Sequence Viewer

Length: 375 bp
ATGCATGCAATGTTCTTAAATATATTGCTTGATGTGCTGGTTTTGATATGCAGATTATTAGAGTACAATCATGAAGGATATGCACGAATCGGTGCGATGCCACGCTACGGCAATGCAGATTCAACACACTGGTTTAAAGTTGAACCCAATTGCACATTTCACATAATCAATAGTTTTGAAGATGGTGATGAGGTTGTAGTGTGGGGTTGTAAAGCTCTGGACTCAATTATACCAGGACCTGACATGGCATCGACTCAATTTGGGTGGTTGCCAAGAAAATTTAAGCCTACAAGTCCAAGTAAAGAAAATGATCATGATACTATCTCATCAGTCGACTATGGAAACTTATTTTTCATGCTTATGAATGGAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RPE65

Protein Analysis

125

Amino Acids

14.09

Weight (kDa)

5.02

Isoelectric Point (pI)

32.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPE65 PF03055 19 - 76 1.9e-10 Retinal pigment epithelial membrane protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 333
AcsI RAATTY 1 cut(s) 278
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 107
AgsI TTSAA 3 cut(s) 123, 143, 179
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwNI CAGNNNCTG 1 cut(s) 239
ApoI RAATTY 1 cut(s) 278
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 197
AvaII GGWCC 1 cut(s) 236
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 234
BclI TGATCA 1 cut(s) 310
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 234
BmsI GCATC 2 cut(s) 87, 257
Bsc4I CCNNNNNNNGG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 134
Bse3DI GCAATG 2 cut(s) 15, 118
BseBI CCWGG 1 cut(s) 234
BseLI CCNNNNNNNGG 1 cut(s) 107
BseMI GCAATG 2 cut(s) 15, 118
BseNI ACTGG 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 107
Bsp143I GATC 1 cut(s) 310
BspHI TCATGA 2 cut(s) 70, 313
BsrDI GCAATG 2 cut(s) 15, 118
BsrI ACTGG 1 cut(s) 134
BssMI GATC 1 cut(s) 310
Bst2UI CCWGG 1 cut(s) 234
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 313
BstMBI GATC 1 cut(s) 310
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNI CCWGG 1 cut(s) 234
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 232
BtgZI GCGATG 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 127
Cac8I GCNNGC 1 cut(s) 6
CaiI CAGNNNCTG 1 cut(s) 239
CciI TCATGA 2 cut(s) 70, 313
Cfr13I GGNCC 1 cut(s) 236
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 245, 280
CviAII CATG 5 cut(s) 5, 71, 244, 314, 355
CviJI RGCY 2 cut(s) 215, 286
CviKI_1 RGCY 2 cut(s) 215, 286
CviQI GTAC 1 cut(s) 64
DpnI GATC 1 cut(s) 312
DpnII GATC 1 cut(s) 310
DraI TTTAAA 1 cut(s) 136
Eco47I GGWCC 1 cut(s) 236
EcoO109I RGGNCCY 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 232
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 5 cut(s) 8, 74, 247, 317, 358
FatI CATG 5 cut(s) 4, 70, 243, 313, 354
FbaI TGATCA 1 cut(s) 310
FblI GTMKAC 1 cut(s) 333
Hin1II CATG 5 cut(s) 8, 74, 247, 317, 358
HincII GTYRAC 1 cut(s) 334
HindII GTYRAC 1 cut(s) 334
HinfI GANTC 4 cut(s) 87, 119, 221, 253
HphI GGTGA 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 334
Hpy188III TCNNGA 3 cut(s) 71, 218, 314
Hpy8I GTNNAC 1 cut(s) 334
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 6 cut(s) 4, 8, 51, 83, 116, 153
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
Hsp92II CATG 5 cut(s) 8, 74, 247, 317, 358
Ksp22I TGATCA 1 cut(s) 310
Kzo9I GATC 1 cut(s) 310
LpnPI CCDG 6 cut(s) 23, 115, 203, 219, 246, 252
LweI GCATC 2 cut(s) 87, 257
MalI GATC 1 cut(s) 312
MboI GATC 1 cut(s) 310
MboII GAAGA 1 cut(s) 191
MfeI CAATTG 1 cut(s) 148
MluCI AATT 4 cut(s) 148, 225, 257, 278
MlyI GAGTC 2 cut(s) 215, 247
MnlI CCTC 1 cut(s) 184
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 4 cut(s) 17, 135, 282, 373
MslI CAYNNNNRTG 1 cut(s) 359
MspR9I CCNGG 1 cut(s) 234
MunI CAATTG 1 cut(s) 148
MvaI CCWGG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 1 cut(s) 310
NlaIII CATG 5 cut(s) 8, 74, 247, 317, 358
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PagI TCATGA 2 cut(s) 70, 313
PfeI GAWTC 2 cut(s) 87, 119
PleI GAGTC 2 cut(s) 215, 247
PpsI GAGTC 2 cut(s) 215, 247
PpuMI RGGWCCY 1 cut(s) 236
Psp5II RGGWCCY 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspPI GGNCC 1 cut(s) 236
PspPPI RGGWCCY 1 cut(s) 236
PstNI CAGNNNCTG 1 cut(s) 239
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
RseI CAYNNNNRTG 1 cut(s) 359
SalI GTCGAC 1 cut(s) 332
SaqAI TTAA 4 cut(s) 17, 135, 282, 373
Sau3AI GATC 1 cut(s) 310
Sau96I GGNCC 1 cut(s) 236
SchI GAGTC 2 cut(s) 215, 247
ScrFI CCNGG 1 cut(s) 234
SetI ASST 3 cut(s) 195, 217, 241
SfaNI GCATC 2 cut(s) 87, 257
SinI GGWCC 1 cut(s) 236
SmiMI CAYNNNNRTG 1 cut(s) 359
SphI GCATGC 1 cut(s) 8
Sse9I AATT 4 cut(s) 148, 225, 257, 278
StyD4I CCNGG 1 cut(s) 232
TaqI TCGA 2 cut(s) 251, 333
TasI AATT 4 cut(s) 148, 225, 257, 278
TatI WGTACW 1 cut(s) 63
TfiI GAWTC 2 cut(s) 87, 119
Tru1I TTAA 4 cut(s) 17, 135, 282, 373
Tru9I TTAA 4 cut(s) 17, 135, 282, 373
TscAI CASTG 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 87, 343
TspRI CASTG 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 278
XceI RCATGY 1 cut(s) 8
XmiI GTMKAC 1 cut(s) 333
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.