MD08G1114800.v1.1

Carotenoid 9,10(9',10')-cleavage dioxygenase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0013626
Physical Location & Seq
Forward (+)
10358944 .. 10359758
815 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1114800.v1.1.491

Sequence Viewer

Length: 444 bp
ATGGATTTTTCCATGATCAATGGAGCTTTCTCCGGCGTTAAAAATAGATATGGCTACGCCCAAGTGGTTGATTCCGTCGCAAGCTCTGCCTCAGGCATGCTCAAATATAATGGTCTAGCCAAGCTACACTTTGAAGAACCAGCTGATGTTTCTTTGAGAAGTGAAGGCCAATTAGAAGAGGCAATAAAGTTGGAAACTCACATGTTTGAGGAGAACAGCTTTTGCACTGGAGCTTCTTTTGTCCCAAAACAAGGGGGTTTTGAAGAAGATGATGGATGGCTTATCACTTTTGTTCACAATGACGATACCAACATATCTCAAGTTTATGTGATCGAGACAAAGAAGCTTTCCAATGAGCCTGTTGCCAAAATTACATTGCCCTGTAGAGCTCCATACGAATTTCATGGAGCCTTTATGCCAATCTCATCACCCACTTATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RPE65

Protein Analysis

148

Amino Acids

16.29

Weight (kDa)

4.73

Isoelectric Point (pI)

46.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPE65 PF03055 1 - 140 3.6e-28 Retinal pigment epithelial membrane protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 398
AfiI CCNNNNNNNGG 1 cut(s) 251
AflIII ACRYGT 1 cut(s) 201
AgsI TTSAA 2 cut(s) 134, 263
AluBI AGCT 8 cut(s) 26, 84, 124, 143, 219, 233, 346, 389
AluI AGCT 8 cut(s) 26, 84, 124, 143, 219, 233, 346, 389
Alw21I GWGCWC 1 cut(s) 391
Alw26I GTCTC 1 cut(s) 329
AoxI GGCC 1 cut(s) 166
ApoI RAATTY 1 cut(s) 398
AsuHPI GGTGA 1 cut(s) 420
AxyI CCTNAGG 1 cut(s) 91
BanII GRGCYC 1 cut(s) 391
Bbv12I GWGCWC 1 cut(s) 391
BccI CCATC 2 cut(s) 266, 270
BclI TGATCA 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 329
BfaI CTAG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 382
BmiI GGNNCC 1 cut(s) 409
BpmI CTGGAG 1 cut(s) 249
BpuEI CTTGAG 1 cut(s) 303
Bsc4I CCNNNNNNNGG 1 cut(s) 251
Bse1I ACTGG 1 cut(s) 232
Bse21I CCTNAGG 1 cut(s) 91
Bse3DI GCAATG 1 cut(s) 374
BseGI GGATG 1 cut(s) 281
BseLI CCNNNNNNNGG 1 cut(s) 251
BseMI GCAATG 1 cut(s) 374
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 232
BseRI GAGGAG 1 cut(s) 224
BshFI GGCC 1 cut(s) 168
BsiHKAI GWGCWC 1 cut(s) 391
BsiSI CCGG 1 cut(s) 33
BslFI GGGAC 1 cut(s) 227
BslI CCNNNNNNNGG 1 cut(s) 251
BsmAI GTCTC 1 cut(s) 329
BsmFI GGGAC 1 cut(s) 227
BsnI GGCC 1 cut(s) 168
Bsp1286I GDGCHC 1 cut(s) 391
Bsp143I GATC 2 cut(s) 15, 330
BspANI GGCC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 104
BspLI GGNNCC 1 cut(s) 409
BsrDI GCAATG 1 cut(s) 374
BsrI ACTGG 1 cut(s) 232
BssMI GATC 2 cut(s) 15, 330
Bst6I CTCTTC 1 cut(s) 171
BstAPI GCANNNNNTGC 1 cut(s) 86
BstC8I GCNNGC 2 cut(s) 82, 98
BstDEI CTNAG 1 cut(s) 91
BstF5I GGATG 1 cut(s) 281
BstKTI GATC 2 cut(s) 18, 333
BstMAI GTCTC 1 cut(s) 329
BstMBI GATC 2 cut(s) 15, 330
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNSI RCATGY 2 cut(s) 100, 205
BstSFI CTRYAG 1 cut(s) 382
Bsu36I CCTNAGG 1 cut(s) 91
BsuRI GGCC 1 cut(s) 168
BtsCI GGATG 1 cut(s) 281
BtsIMutI CAGTG 1 cut(s) 225
Cac8I GCNNGC 2 cut(s) 82, 98
CviAII CATG 4 cut(s) 13, 97, 202, 404
DdeI CTNAG 1 cut(s) 91
DpnI GATC 2 cut(s) 17, 332
DpnII GATC 2 cut(s) 15, 330
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
Ecl136II GAGCTC 1 cut(s) 389
Eco24I GRGCYC 1 cut(s) 391
Eco53kI GAGCTC 1 cut(s) 389
Eco81I CCTNAGG 1 cut(s) 91
EcoICRI GAGCTC 1 cut(s) 389
EcoT38I GRGCYC 1 cut(s) 391
FaeI CATG 4 cut(s) 16, 100, 205, 407
FalI AAGNNNNNCTT 2 cut(s) 113, 145
FaqI GGGAC 1 cut(s) 227
FatI CATG 4 cut(s) 12, 96, 201, 403
FbaI TGATCA 1 cut(s) 15
FokI GGATG 1 cut(s) 288
FriOI GRGCYC 1 cut(s) 391
FspBI CTAG 1 cut(s) 116
GsuI CTGGAG 1 cut(s) 249
HaeIII GGCC 1 cut(s) 168
HapII CCGG 1 cut(s) 33
Hin1II CATG 4 cut(s) 16, 100, 205, 407
HindIII AAGCTT 1 cut(s) 344
HinfI GANTC 1 cut(s) 71
HpaII CCGG 1 cut(s) 33
HphI GGTGA 1 cut(s) 420
Hpy166II GTNNAC 1 cut(s) 295
Hpy188III TCNNGA 1 cut(s) 334
Hpy8I GTNNAC 1 cut(s) 295
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 91
Hsp92II CATG 4 cut(s) 16, 100, 205, 407
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 2 cut(s) 15, 330
LmnI GCTCC 4 cut(s) 23, 230, 394, 407
LpnPI CCDG 6 cut(s) 46, 78, 153, 213, 372, 394
MaeI CTAG 1 cut(s) 116
MalI GATC 2 cut(s) 17, 332
MboI GATC 2 cut(s) 15, 330
MboII GAAGA 4 cut(s) 146, 188, 275, 278
MhlI GDGCHC 1 cut(s) 391
MluCI AATT 3 cut(s) 170, 369, 398
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 3 cut(s) 100, 172, 202
MseI TTAA 1 cut(s) 39
MspA1I CMGCKG 1 cut(s) 143
MspI CCGG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 2 cut(s) 15, 330
NlaIII CATG 4 cut(s) 16, 100, 205, 407
NlaIV GGNNCC 1 cut(s) 409
NspI RCATGY 2 cut(s) 100, 205
PaeI GCATGC 1 cut(s) 100
PciI ACATGT 1 cut(s) 201
PfeI GAWTC 1 cut(s) 71
PscI ACATGT 1 cut(s) 201
Psp124BI GAGCTC 1 cut(s) 391
PspN4I GGNNCC 1 cut(s) 409
PvuII CAGCTG 1 cut(s) 143
SacI GAGCTC 1 cut(s) 391
SaqAI TTAA 1 cut(s) 39
Sau3AI GATC 2 cut(s) 15, 330
SduI GDGCHC 1 cut(s) 391
SetI ASST 8 cut(s) 28, 86, 126, 145, 221, 235, 348, 391
SfcI CTRYAG 1 cut(s) 382
SmlI CTYRAG 1 cut(s) 318
SmoI CTYRAG 1 cut(s) 318
SphI GCATGC 1 cut(s) 100
Sse9I AATT 3 cut(s) 170, 369, 398
SspMI CTAG 1 cut(s) 116
SstI GAGCTC 1 cut(s) 391
TaqI TCGA 1 cut(s) 333
TasI AATT 3 cut(s) 170, 369, 398
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 1 cut(s) 392
TspGWI ACGGA 1 cut(s) 64
TspRI CASTG 1 cut(s) 232
XapI RAATTY 1 cut(s) 398
XceI RCATGY 2 cut(s) 100, 205
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.