MD09G1117500.v1.1

Protein of unknown function (DUF1664)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
9028864 .. 9029357
494 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1117500.v1.1.491

Sequence Viewer

Length: 222 bp
ATGGTCTCTGGGTTGGGAAGGTCGATCTTATTGAGAGCAAACAGGTTATATTTCTGGTTATGCATTCACTTTGGAAACCTTCGCTGTTTTCTATGGTATCTATGCCAAGTAGCAGATGGCGTCAAAGGTCAGCTGGATACTAAACCATTACAGCACGTCTCAGCTAAGCTAGGAAAGCATTCAACAACGGCATTAGAGGATAAATCACCCAAGGTATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.29

Weight (kDa)

9.61

Isoelectric Point (pI)

27.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010965)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 216
AcyI GRCGYC 1 cut(s) 120
AgsI TTSAA 1 cut(s) 183
AjiI CACGTC 1 cut(s) 157
AluBI AGCT 3 cut(s) 133, 164, 169
AluI AGCT 3 cut(s) 133, 164, 169
Alw26I GTCTC 2 cut(s) 10, 163
Asp700I GAANNNNTTC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 198
BccI CCATC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 204
BciVI GTATCC 1 cut(s) 130
BcoDI GTCTC 2 cut(s) 10, 163
BfaI CTAG 1 cut(s) 170
BfuI GTATCC 1 cut(s) 130
BlpI GCTNAGC 1 cut(s) 165
BmgBI CACGTC 1 cut(s) 157
Bpu1102I GCTNAGC 1 cut(s) 165
BsaHI GRCGYC 1 cut(s) 120
BsaI GGTCTC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 210
BseMII CTCAG 1 cut(s) 174
BsmAI GTCTC 2 cut(s) 10, 163
BsmBI CGTCTC 1 cut(s) 163
BsmI GAATGC 2 cut(s) 63, 178
Bso31I GGTCTC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 24
Bsp1720I GCTNAGC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 173
BspTNI GGTCTC 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 1 cut(s) 24
BssNAI GTATAC 1 cut(s) 217
BssNI GRCGYC 1 cut(s) 120
BssT1I CCWWGG 1 cut(s) 210
Bst1107I GTATAC 1 cut(s) 217
BstACI GRCGYC 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 160, 165
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 2 cut(s) 10, 163
BstMBI GATC 1 cut(s) 24
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstZ17I GTATAC 1 cut(s) 217
BsuI GTATCC 1 cut(s) 130
BtrI CACGTC 1 cut(s) 157
CseI GACGC 1 cut(s) 109
CviJI RGCY 3 cut(s) 133, 164, 169
CviKI_1 RGCY 3 cut(s) 133, 164, 169
DdeI CTNAG 2 cut(s) 160, 165
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 210
Eco31I GGTCTC 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 210
EcoT22I ATGCAT 1 cut(s) 65
ErhI CCWWGG 1 cut(s) 210
Esp3I CGTCTC 1 cut(s) 163
FaiI YATR 5 cut(s) 49, 61, 94, 103, 217
FblI GTMKAC 1 cut(s) 216
FspBI CTAG 1 cut(s) 170
HgaI GACGC 1 cut(s) 109
Hin1I GRCGYC 1 cut(s) 120
HphI GGTGA 1 cut(s) 198
Hpy166II GTNNAC 1 cut(s) 217
Hpy8I GTNNAC 1 cut(s) 217
HpyAV CCTTC 2 cut(s) 12, 89
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 63
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 160, 165
HpySE526I ACGT 1 cut(s) 156
Hsp92I GRCGYC 1 cut(s) 120
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 28, 40, 119
MaeI CTAG 1 cut(s) 170
MaeII ACGT 1 cut(s) 156
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MnlI CCTC 1 cut(s) 190
Mph1103I ATGCAT 1 cut(s) 65
MroXI GAANNNNTTC 1 cut(s) 178
MspA1I CMGCKG 1 cut(s) 133
Mva1269I GAATGC 2 cut(s) 63, 178
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeII GATC 1 cut(s) 24
NsiI ATGCAT 1 cut(s) 65
PctI GAATGC 2 cut(s) 63, 178
PdmI GAANNNNTTC 1 cut(s) 178
PvuII CAGCTG 1 cut(s) 133
Sau3AI GATC 1 cut(s) 24
SetI ASST 9 cut(s) 23, 47, 81, 130, 135, 159, 166, 171, 216
SgeI CNNG 7 cut(s) 21, 55, 67, 119, 146, 167, 182
SspMI CTAG 1 cut(s) 170
StyI CCWWGG 1 cut(s) 210
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 23
XcmI CCANNNNNNNNNTGG 1 cut(s) 113
XmiI GTMKAC 1 cut(s) 216
XmnI GAANNNNTTC 1 cut(s) 178
XspI CTAG 1 cut(s) 170
Zsp2I ATGCAT 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.