MD10G1257500.v1.1
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
35162456 .. 35163487
1032 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1257500.v1.1.491

Sequence Viewer

Length: 318 bp
ATGTCAAAGAGACCTGAGCTTGGTCGATTGTTCAGTGAGGCTATGACCGCTTACTCTGCTATATGTTTTGATCAAAAGGTATTCACTGAATATAAAGGTTTTGAAGAGGTGACAGAGCTGATGGACGTAGGAGGTGTGAAGCATGTTGCGGGAAATATGTTTGAGTCAATACCACATGCTCAGTCGATAATGATGAAGTTGCTGAGAAACTGTTGGAATGCGTTACCGGAAACTAGGAAGGTAATAGTTGTGGAATTTGTAGTACCTGAAGTACTGGAAAATACACCAGAAACAAGGAACACACTCGCCTCGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.89

Weight (kDa)

5.36

Isoelectric Point (pI)

44.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 48, 149
AcsI RAATTY 1 cut(s) 254
AcuI CTGAAG 1 cut(s) 288
AfaI GTAC 2 cut(s) 264, 273
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 104
AluBI AGCT 2 cut(s) 19, 118
AluI AGCT 2 cut(s) 19, 118
Alw26I GTCTC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 254
AsuHPI GGTGA 1 cut(s) 121
BccI CCATC 1 cut(s) 115
BclI TGATCA 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 4
BfaI CTAG 1 cut(s) 234
BmcAI AGTACT 1 cut(s) 273
Bpu10I CCTNAGC 1 cut(s) 15
BsaI GGTCTC 1 cut(s) 4
BsaWI WCCGGW 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 3 cut(s) 6, 194, 194
BseNI ACTGG 1 cut(s) 279
BsiSI CCGG 1 cut(s) 227
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 4
BsmI GAATGC 1 cut(s) 223
Bso31I GGTCTC 1 cut(s) 4
Bsp143I GATC 1 cut(s) 70
BspACI CCGC 2 cut(s) 48, 149
BspCNI CTCAG 3 cut(s) 7, 193, 195
BspTNI GGTCTC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 279
BssMI GATC 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 212
Bst6I CTCTTC 1 cut(s) 99
BstDEI CTNAG 3 cut(s) 15, 180, 203
BstKTI GATC 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 4
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 2 cut(s) 47, 56
BstNSI RCATGY 2 cut(s) 146, 179
BtsIMutI CAGTG 2 cut(s) 40, 84
Csp6I GTAC 2 cut(s) 263, 272
CviAII CATG 3 cut(s) 143, 176, 315
CviJI RGCY 3 cut(s) 19, 41, 118
CviKI_1 RGCY 3 cut(s) 19, 41, 118
CviQI GTAC 2 cut(s) 263, 272
DdeI CTNAG 3 cut(s) 15, 180, 203
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco31I GGTCTC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 288
FaeI CATG 3 cut(s) 146, 179, 318
FaiI YATR 8 cut(s) 44, 62, 64, 93, 144, 158, 177, 316
FatI CATG 3 cut(s) 142, 175, 314
FauI CCCGC 1 cut(s) 142
FbaI TGATCA 1 cut(s) 70
FspBI CTAG 1 cut(s) 234
HapII CCGG 1 cut(s) 227
Hin1II CATG 3 cut(s) 146, 179, 318
HinfI GANTC 1 cut(s) 164
HpaII CCGG 1 cut(s) 227
HphI GGTGA 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 232
HpyCH4III ACNGT 1 cut(s) 212
HpyCH4IV ACGT 1 cut(s) 126
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 56
HpyF3I CTNAG 3 cut(s) 15, 180, 203
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 3 cut(s) 146, 179, 318
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 5 cut(s) 27, 240, 260, 279, 300
MaeI CTAG 1 cut(s) 234
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 2 cut(s) 109, 222
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 1 cut(s) 116
MluCI AATT 1 cut(s) 254
MlyI GAGTC 1 cut(s) 173
MmeI TCCRAC 1 cut(s) 194
MnlI CCTC 3 cut(s) 31, 100, 125
MspI CCGG 1 cut(s) 227
Mva1269I GAATGC 1 cut(s) 223
MwoI GCNNNNNNNGC 2 cut(s) 47, 56
NdeII GATC 1 cut(s) 70
NlaIII CATG 3 cut(s) 146, 179, 318
NmuCI GTSAC 1 cut(s) 109
NspI RCATGY 2 cut(s) 146, 179
PctI GAATGC 1 cut(s) 223
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
RsaI GTAC 2 cut(s) 264, 273
RsaNI GTAC 2 cut(s) 263, 272
Sau3AI GATC 1 cut(s) 70
ScaI AGTACT 1 cut(s) 273
SchI GAGTC 1 cut(s) 173
Sse9I AATT 1 cut(s) 254
SsiI CCGC 2 cut(s) 48, 149
SspMI CTAG 1 cut(s) 234
TaaI ACNGT 1 cut(s) 212
TaiI ACGT 1 cut(s) 129
TaqI TCGA 3 cut(s) 25, 185, 311
TasI AATT 1 cut(s) 254
TatI WGTACW 1 cut(s) 271
TscAI CASTG 2 cut(s) 40, 91
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 209
TspRI CASTG 2 cut(s) 40, 91
XapI RAATTY 1 cut(s) 254
XceI RCATGY 2 cut(s) 146, 179
XspI CTAG 1 cut(s) 234
ZrmI AGTACT 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.