MD11G1043900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0000794
Physical Location & Seq
Forward (+)
3883630 .. 3884162
533 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1043900.v1.1.491

Sequence Viewer

Length: 192 bp
ATGCCTCAGAGAAATTTAGTTGAATTTATCTGTGAAATTGTTGTTTTTTTTTTGGTTCCTAATGTGCTATTGAAAGCTCTGGAGGCAGAGCACCCAATAATCGACTCCAATTTCCAGACGAACACAAGGTCATCTTCTCTGCAGGTTCTTCACTACCAGAGAAGTGGGTTTAATTTGAAAAGAGTTTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.31

Weight (kDa)

7.98

Isoelectric Point (pI)

55.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000794)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07745 AT1G07745 AT1G07745 AT1G07745 AT1G07745
fragaria_vesca FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810 FvH4_3g34810
malus_domestica MD11G1043900.v1.1 MD11G1115100.v1.1
prunus_persica Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G066800_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1 Prupe.6G086100_v2.0.a1
pyrus_communis pycom11g09660
rosa_chinensis RchiOBHm_Chr5g0062661
rosa_laevigata RLG00000035569
rosa_multiflora Rmu_sc0006470.1_g000002 Rmu_ssc0000472.1_g000029
rosa_roxburghii Rroxscaffold_1G00017970
rosa_rugosa Rorug05G0350700 Rorug05G0350800
rosa_samantha Rh5AG411600 Rh5BG425600 Rh5CG449700 Rh5DG439600
rosa_wichuraiana Rw5G038700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 133
AcsI RAATTY 2 cut(s) 13, 23
AgsI TTSAA 3 cut(s) 23, 73, 178
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw21I GWGCWC 1 cut(s) 93
ApoI RAATTY 2 cut(s) 13, 23
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
Bbv12I GWGCWC 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 140
BfuAI ACCTGC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 57
BpmI CTGGAG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 20
BsiHKAI GWGCWC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 144
BspMI ACCTGC 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 140
BstXI CCANNNNNNTGG 1 cut(s) 164
BveI ACCTGC 1 cut(s) 133
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
DdeI CTNAG 1 cut(s) 6
FaiI YATR 1 cut(s) 190
FalI AAGNNNNNCTT 2 cut(s) 118, 150
GsuI CTGGAG 1 cut(s) 101
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 80, 115
HpyCH4V TGCA 1 cut(s) 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 6
LpnPI CCDG 4 cut(s) 65, 128, 128, 170
MboII GAAGA 2 cut(s) 126, 140
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 5 cut(s) 13, 23, 36, 109, 172
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 2 cut(s) 15, 76
MseI TTAA 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 57
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 57
PstI CTGCAG 1 cut(s) 144
SaqAI TTAA 1 cut(s) 171
SchI GAGTC 1 cut(s) 98
SduI GDGCHC 1 cut(s) 93
SetI ASST 3 cut(s) 79, 131, 147
SfcI CTRYAG 1 cut(s) 140
SgeI CNNG 5 cut(s) 92, 127, 138, 155, 169
Sse9I AATT 5 cut(s) 13, 23, 36, 109, 172
TaqI TCGA 1 cut(s) 102
TasI AATT 5 cut(s) 13, 23, 36, 109, 172
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
XapI RAATTY 2 cut(s) 13, 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.