Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0002249

Physical Location & Seq

Genomic Coordinates Forward (+)

4515066 .. 4515774

Gene Structure 709 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1053100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGTTGCAATGGATGGGAGGATCGAGGCGGAAAGTAACGACTTCAAGGAAGTCTACACAGCAGAGGCAAAAGCAGTACTTTGAACAAAGAAGACGACAACAACAGCGTCAGGGGCAAACAACTGGGTTAGAGAGTTACGCAGATGGCCTAAACATATCTGAACAACATCACAAAGAACATCGATCTTTGGATATTCTCAGTTTGCTGAACCTATCAACAACTGCTCAAGAACACAAATCTTCTTACCCTATTCGTAAGTTCCTAATATCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

91

Amino Acids

10.66

Weight (kDa)

10.71

Isoelectric Point (pI)

83.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002249)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480 AT2G30480
fragaria_vesca	FvH4_3g40550 FvH4_3g40550
malus_domestica	MD11G1053100.v1.1 MD11G1053200.v1.1 MD11G1053300.v1.1
prunus_persica	Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1 Prupe.6G040800_v2.0.a1
pyrus_communis	pycom11g04320
rosa_chinensis	RchiOBHm_Chr5g0073231
rosa_laevigata	RLG00000036376
rosa_multiflora	Rmu_sc0001887.1_g000014
rosa_roxburghii	Rroxscaffold_1G00007960
rosa_rugosa	Rorug05G0422400 Rorug05G0422500
rosa_samantha	Rh5AG479200 Rh5BG499900 Rh5CG523100 Rh5DG512000
rosa_wichuraiana	Rw5G044550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	53
AciI	CCGC	1 cut(s)	28
AclWI	GGATC	1 cut(s)	28
AfaI	GTAC	1 cut(s)	77
AgsI	TTSAA	2 cut(s)	45, 83
AlwI	GGATC	1 cut(s)	28
AoxI	GGCC	1 cut(s)	145
BbsI	GAAGAC	1 cut(s)	97
BccI	CCATC	2 cut(s)	7, 137
BmcAI	AGTACT	1 cut(s)	77
BmrI	ACTGGG	1 cut(s)	132
BmuI	ACTGGG	1 cut(s)	132
BpiI	GAAGAC	1 cut(s)	97
BpuEI	CTTGAG	1 cut(s)	210
Bsa29I	ATCGAT	1 cut(s)	181
Bse1I	ACTGG	1 cut(s)	127
Bse3DI	GCAATG	1 cut(s)	14
BseCI	ATCGAT	1 cut(s)	181
BseGI	GGATG	1 cut(s)	18
BseMI	GCAATG	1 cut(s)	14
BseMII	CTCAG	1 cut(s)	211
BseNI	ACTGG	1 cut(s)	127
BshFI	GGCC	1 cut(s)	147
BshVI	ATCGAT	1 cut(s)	181
BsnI	GGCC	1 cut(s)	147
Bsp143I	GATC	2 cut(s)	20, 182
BspACI	CCGC	1 cut(s)	28
BspANI	GGCC	1 cut(s)	147
BspCNI	CTCAG	1 cut(s)	210
BspDI	ATCGAT	1 cut(s)	181
BspPI	GGATC	1 cut(s)	28
BsrDI	GCAATG	1 cut(s)	14
BsrI	ACTGG	1 cut(s)	127
BssMI	GATC	2 cut(s)	20, 182
BstDEI	CTNAG	1 cut(s)	197
BstF5I	GGATG	1 cut(s)	18
BstKTI	GATC	2 cut(s)	23, 185
BstMBI	GATC	2 cut(s)	20, 182
BstMWI	GCNNNNNNNGC	1 cut(s)	112
BstV2I	GAAGAC	1 cut(s)	97
Bsu15I	ATCGAT	1 cut(s)	181
BsuRI	GGCC	1 cut(s)	147
BsuTUI	ATCGAT	1 cut(s)	181
BtsCI	GGATG	1 cut(s)	18
ClaI	ATCGAT	1 cut(s)	181
CseI	GACGC	1 cut(s)	95
Csp6I	GTAC	1 cut(s)	76
CviJI	RGCY	1 cut(s)	147
CviKI_1	RGCY	1 cut(s)	147
CviQI	GTAC	1 cut(s)	76
DdeI	CTNAG	1 cut(s)	197
DpnI	GATC	2 cut(s)	22, 184
DpnII	GATC	2 cut(s)	20, 182
EciI	GGCGGA	1 cut(s)	43
FaiI	YATR	1 cut(s)	155
FalI	AAGNNNNNCTT	2 cut(s)	62, 94
FblI	GTMKAC	1 cut(s)	53
FokI	GGATG	1 cut(s)	25
HaeIII	GGCC	1 cut(s)	147
HgaI	GACGC	1 cut(s)	95
Hpy166II	GTNNAC	1 cut(s)	54
Hpy188I	TCNGA	1 cut(s)	160
Hpy188III	TCNNGA	1 cut(s)	227
Hpy8I	GTNNAC	1 cut(s)	54
HpyCH4V	TGCA	1 cut(s)	7
HpyF10VI	GCNNNNNNNGC	1 cut(s)	112
HpyF3I	CTNAG	1 cut(s)	197
Kzo9I	GATC	2 cut(s)	20, 182
LpnPI	CCDG	2 cut(s)	95, 108
MaeIII	GTNAC	2 cut(s)	34, 134
MalI	GATC	2 cut(s)	22, 184
MboI	GATC	2 cut(s)	20, 182
MboII	GAAGA	2 cut(s)	102, 231
MnlI	CCTC	3 cut(s)	11, 18, 57
MseI	TTAA	1 cut(s)	271
MwoI	GCNNNNNNNGC	1 cut(s)	112
NdeII	GATC	2 cut(s)	20, 182
RsaI	GTAC	1 cut(s)	77
RsaNI	GTAC	1 cut(s)	76
SaqAI	TTAA	1 cut(s)	271
Sau3AI	GATC	2 cut(s)	20, 182
ScaI	AGTACT	1 cut(s)	77
SetI	ASST	1 cut(s)	213
SgeI	CNNG	5 cut(s)	36, 57, 122, 135, 239
SmlI	CTYRAG	1 cut(s)	225
SmoI	CTYRAG	1 cut(s)	225
SsiI	CCGC	1 cut(s)	28
TaqI	TCGA	2 cut(s)	23, 181
TatI	WGTACW	1 cut(s)	75
Tru1I	TTAA	1 cut(s)	271
Tru9I	TTAA	1 cut(s)	271
XmiI	GTMKAC	1 cut(s)	53
ZrmI	AGTACT	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.