MD13G1172800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0015289
Physical Location & Seq
Reverse (-)
14171018 .. 14172660
1643 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1172800.v1.1.491

Sequence Viewer

Length: 180 bp
ATGTTGTTGCCTCTTTTTTGTATGCATTTTTCTGTGCACGCTTCATGCCGAAAGAAGAACGAGCAAGCCACTTTCTTGGAGGATTTGAAGGATCACATTGATGATTTTGTTAATGCATACTTGCTTCAAGATCACCGTGGAAAAGTTCTTTGGAATGTCCAAGAGTTGTCGCAGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.03

Weight (kDa)

6.38

Isoelectric Point (pI)

62.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015289)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G27050
fragaria_vesca FvH4_4g32080
malus_domestica MD13G1079700.v1.1 MD13G1172800.v1.1
prunus_persica Prupe.1G267100_v2.0.a1
pyrus_communis pycom03g02960
rosa_chinensis RchiOBHm_Chr4g0440771
rosa_laevigata RLG00000006155
rosa_roxburghii Rroxscaffold_5G00381530
rosa_rugosa Rorug04G0327800
rosa_samantha Rh4AG379600 Rh4BG392500 Rh4CG407300 Rh4DG386300
rosa_wichuraiana Rw4G032650 Rw4G032680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 99
AgsI TTSAA 2 cut(s) 88, 128
AjuI GAANNNNNNNTTGG 2 cut(s) 133, 165
Alw21I GWGCWC 1 cut(s) 39
Alw44I GTGCAC 1 cut(s) 35
AlwI GGATC 1 cut(s) 99
ApaLI GTGCAC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 125
BaeGI GKGCMC 1 cut(s) 39
Bbv12I GWGCWC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 136
BseDI CCNNGG 1 cut(s) 136
BseSI GKGCMC 1 cut(s) 39
BsiHKAI GWGCWC 1 cut(s) 39
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 91, 130
BspPI GGATC 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 2 cut(s) 91, 130
Bst4CI ACNGT 1 cut(s) 137
BstC8I GCNNGC 2 cut(s) 39, 66
BstDSI CCRYGG 1 cut(s) 136
BstKTI GATC 2 cut(s) 94, 133
BstMBI GATC 2 cut(s) 91, 130
BstSLI GKGCMC 1 cut(s) 39
BstXI CCANNNNNNTGG 1 cut(s) 76
BtgI CCRYGG 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 39, 66
CviAII CATG 1 cut(s) 45
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
DpnI GATC 2 cut(s) 93, 132
DpnII GATC 2 cut(s) 91, 130
EcoT22I ATGCAT 2 cut(s) 27, 118
FaeI CATG 1 cut(s) 48
FaiI YATR 3 cut(s) 23, 46, 118
FatI CATG 1 cut(s) 44
Hin1II CATG 1 cut(s) 48
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 3 cut(s) 25, 37, 116
Hsp92II CATG 1 cut(s) 48
Kzo9I GATC 2 cut(s) 91, 130
MalI GATC 2 cut(s) 93, 132
MboI GATC 2 cut(s) 91, 130
MboII GAAGA 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 39
MnlI CCTC 2 cut(s) 21, 73
Mph1103I ATGCAT 2 cut(s) 27, 118
MseI TTAA 1 cut(s) 111
MslI CAYNNNNRTG 1 cut(s) 99
NdeII GATC 2 cut(s) 91, 130
NlaIII CATG 1 cut(s) 48
NsiI ATGCAT 2 cut(s) 27, 118
RseI CAYNNNNRTG 1 cut(s) 99
SaqAI TTAA 1 cut(s) 111
Sau3AI GATC 2 cut(s) 91, 130
SduI GDGCHC 1 cut(s) 39
SgeI CNNG 9 cut(s) 50, 57, 73, 77, 88, 133, 140, 149, 173
SmiMI CAYNNNNRTG 1 cut(s) 99
TaaI ACNGT 1 cut(s) 137
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 33
VneI GTGCAC 1 cut(s) 35
Zsp2I ATGCAT 2 cut(s) 27, 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.