MD14G1025700.v1.1

Glyoxalase-like domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Forward (+)
2349622 .. 2349956
335 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1025700.v1.1.491

Sequence Viewer

Length: 198 bp
ATGGCGATGGCGTCGAAGACAAACATAGTGTTTGCCTACACAGTGATTTACGTGAAGGATGTTGCCAAATCCACAACCTTCTATTCCAAAGCCTTCGGCTACGATATTCGTCGCTTGGAAGACTCCAACATGTGGGGGGAGTTAGAAAGCCGGCAAACGACGATAGCATTCACACCGCTACATCAGCAAGACCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.54

Weight (kDa)

8.06

Isoelectric Point (pI)

49.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ble-like_N PF22677 15 - 43 6.3e-06 Bleomycin resistance protein-like N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013486)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 132
AciI CCGC 1 cut(s) 176
AcyI GRCGYC 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 132
AflIII ACRYGT 1 cut(s) 129
BbsI GAAGAC 2 cut(s) 23, 126
BpiI GAAGAC 2 cut(s) 23, 126
BsaAI YACGTR 1 cut(s) 52
BsaHI GRCGYC 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse118I RCCGGY 1 cut(s) 150
BseGI GGATG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 132
BsiSI CCGG 1 cut(s) 151
BslI CCNNNNNNNGG 1 cut(s) 132
BsmI GAATGC 1 cut(s) 167
BspACI CCGC 1 cut(s) 176
BsrFI RCCGGY 1 cut(s) 150
BssAI RCCGGY 1 cut(s) 150
BssNI GRCGYC 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 43
BstACI GRCGYC 1 cut(s) 11
BstBAI YACGTR 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 152
BstF5I GGATG 1 cut(s) 64
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNSI RCATGY 1 cut(s) 133
BstV2I GAAGAC 2 cut(s) 23, 126
BtgZI GCGATG 1 cut(s) 20
BtsCI GGATG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 150
CviAII CATG 1 cut(s) 130
CviJI RGCY 3 cut(s) 92, 99, 150
CviKI_1 RGCY 3 cut(s) 92, 99, 150
FaeI CATG 1 cut(s) 133
FaiI YATR 2 cut(s) 26, 131
FatI CATG 1 cut(s) 129
FokI GGATG 1 cut(s) 71
HapII CCGG 1 cut(s) 151
Hin1I GRCGYC 1 cut(s) 11
Hin1II CATG 1 cut(s) 133
HinfI GANTC 1 cut(s) 122
HpaII CCGG 1 cut(s) 151
Hpy99I CGWCG 3 cut(s) 16, 114, 163
HpyAV CCTTC 3 cut(s) 49, 88, 103
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 51
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 51
Hsp92I GRCGYC 1 cut(s) 11
Hsp92II CATG 1 cut(s) 133
KroI GCCGGC 1 cut(s) 150
KroNI GCCGGC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 164
MaeII ACGT 1 cut(s) 51
MboII GAAGA 2 cut(s) 28, 131
MlyI GAGTC 1 cut(s) 116
MmeI TCCRAC 1 cut(s) 150
MroNI GCCGGC 1 cut(s) 150
MspI CCGG 1 cut(s) 151
Mva1269I GAATGC 1 cut(s) 167
MwoI GCNNNNNNNGC 1 cut(s) 184
NaeI GCCGGC 1 cut(s) 152
NgoMIV GCCGGC 1 cut(s) 150
NlaIII CATG 1 cut(s) 133
NspI RCATGY 1 cut(s) 133
PciI ACATGT 1 cut(s) 129
PctI GAATGC 1 cut(s) 167
PdiI GCCGGC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 132
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
Ppu21I YACGTR 1 cut(s) 52
PscI ACATGT 1 cut(s) 129
SchI GAGTC 1 cut(s) 116
SetI ASST 2 cut(s) 54, 80
SgeI CNNG 4 cut(s) 64, 127, 142, 163
SsiI CCGC 1 cut(s) 176
TaaI ACNGT 1 cut(s) 43
TaiI ACGT 1 cut(s) 54
TaqI TCGA 1 cut(s) 14
TscAI CASTG 1 cut(s) 48
TspRI CASTG 1 cut(s) 48
Van91I CCANNNNNTGG 1 cut(s) 132
XceI RCATGY 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.