MD14G1139200.v1.1

subtilisin-like protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0016592
Physical Location & Seq
Forward (+)
22961504 .. 22961906
403 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1139200.v1.1.491

Sequence Viewer

Length: 276 bp
ATGGATGGAGGATTTGCCTTGCTATCAGGGACATCAATGGCAACTCCCCACATTGCACGCATTGTGGCACTTCTAAAATCGTTGCGCCCTGATTGGTCCCCTGCTGCAATAAAATCAGCACTAGTCACAACAGCATGGAAGACTGATCCATTTGGAGAGCCAATCTTTGCTGATGGGGCAGCGCAAAAGCTTGCGGATCCATTTGATTATGGAGGAGGATTATTGAACCTGAACAAGGCAGCGAACCCTGGCCTCATACGATATGGACACCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

92

Amino Acids

9.56

Weight (kDa)

8.11

Isoelectric Point (pI)

28.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S8 PF00082 3 - 57 1.6e-13 Subtilase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016592)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G32980
malus_domestica MD14G1139200.v1.1
pyrus_communis pycom14g11490
rosa_chinensis RchiOBHm_Chr5g0002201
rosa_multiflora Rmu_sc0001492.1_g000003
rosa_roxburghii Rroxscaffold_3G00267180
rosa_rugosa Rorug06G0483500
rosa_samantha Rh5AG017200 Rh7AG088600 Rh7BG090000 Rh7BG090400 Rh7CG089200 Rh7CG089400 Rh7DG090800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AclWI GGATC 3 cut(s) 140, 191, 204
AfiI CCNNNNNNNGG 1 cut(s) 235
AgsI TTSAA 1 cut(s) 226
AhlI ACTAGT 1 cut(s) 121
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 3 cut(s) 140, 191, 204
AoxI GGCC 1 cut(s) 250
ApeKI GCWGC 3 cut(s) 104, 179, 239
AspLEI GCGC 2 cut(s) 87, 184
AspS9I GGNCC 1 cut(s) 96
AvaII GGWCC 1 cut(s) 96
BamHI GGATCC 1 cut(s) 196
BbsI GAAGAC 1 cut(s) 146
BbvI GCAGC 3 cut(s) 91, 191, 251
BccI CCATC 1 cut(s) 167
BciT130I CCWGG 1 cut(s) 249
BcuI ACTAGT 1 cut(s) 121
BfaI CTAG 1 cut(s) 122
BisI GCNGC 3 cut(s) 105, 180, 240
BlsI GCNGC 3 cut(s) 106, 181, 241
Bme1390I CCNGG 1 cut(s) 249
Bme18I GGWCC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 96
BmiI GGNNCC 2 cut(s) 98, 198
BmrFI CCNGG 1 cut(s) 249
BpiI GAAGAC 1 cut(s) 146
BsaJI CCNNGG 1 cut(s) 247
Bsc4I CCNNNNNNNGG 1 cut(s) 235
Bse3DI GCAATG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 247
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 235
BseMI GCAATG 1 cut(s) 51
BseRI GAGGAG 1 cut(s) 228
BseXI GCAGC 3 cut(s) 91, 191, 251
BshFI GGCC 1 cut(s) 252
BslFI GGGAC 2 cut(s) 43, 82
BslI CCNNNNNNNGG 1 cut(s) 235
BsmFI GGGAC 2 cut(s) 43, 82
BsnI GGCC 1 cut(s) 252
Bsp143I GATC 2 cut(s) 145, 196
BspACI CCGC 1 cut(s) 194
BspANI GGCC 1 cut(s) 252
BspLI GGNNCC 2 cut(s) 98, 198
BspPI GGATC 3 cut(s) 140, 191, 204
BsrDI GCAATG 1 cut(s) 51
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 2 cut(s) 145, 196
Bst2UI CCWGG 1 cut(s) 249
BstC8I GCNNGC 2 cut(s) 58, 192
BstENI CCTNNNNNAGG 1 cut(s) 233
BstF5I GGATG 1 cut(s) 10
BstHHI GCGC 2 cut(s) 87, 184
BstKTI GATC 2 cut(s) 148, 199
BstMBI GATC 2 cut(s) 145, 196
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 249
BstSCI CCNGG 1 cut(s) 247
BstV1I GCAGC 3 cut(s) 91, 191, 251
BstV2I GAAGAC 1 cut(s) 146
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuRI GGCC 1 cut(s) 252
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 2 cut(s) 58, 192
CfoI GCGC 2 cut(s) 87, 184
Cfr13I GGNCC 1 cut(s) 96
CviAII CATG 1 cut(s) 135
CviJI RGCY 3 cut(s) 160, 190, 252
CviKI_1 RGCY 3 cut(s) 160, 190, 252
DpnI GATC 2 cut(s) 147, 198
DpnII GATC 2 cut(s) 145, 196
Eco47I GGWCC 1 cut(s) 96
EcoNI CCTNNNNNAGG 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 247
FaeI CATG 1 cut(s) 138
FaiI YATR 4 cut(s) 136, 210, 257, 264
FaqI GGGAC 2 cut(s) 43, 82
FatI CATG 1 cut(s) 134
Fnu4HI GCNGC 3 cut(s) 105, 180, 240
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 3 cut(s) 105, 180, 240
FspBI CTAG 1 cut(s) 122
GlaI GCGC 2 cut(s) 86, 183
GluI GCNGC 3 cut(s) 105, 180, 240
HaeIII GGCC 1 cut(s) 252
HhaI GCGC 2 cut(s) 87, 184
Hin1II CATG 1 cut(s) 138
Hin6I GCGC 2 cut(s) 85, 182
HinP1I GCGC 2 cut(s) 85, 182
HindIII AAGCTT 1 cut(s) 188
HpyCH4V TGCA 2 cut(s) 56, 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
Hsp92II CATG 1 cut(s) 138
HspAI GCGC 2 cut(s) 85, 182
Kzo9I GATC 2 cut(s) 145, 196
LpnPI CCDG 6 cut(s) 12, 102, 114, 234, 242, 261
Lsp1109I GCAGC 3 cut(s) 91, 191, 251
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 124
MalI GATC 2 cut(s) 147, 198
MboI GATC 2 cut(s) 145, 196
MboII GAAGA 1 cut(s) 151
MflI RGATCY 1 cut(s) 196
MnlI CCTC 3 cut(s) 206, 209, 263
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 176
NdeII GATC 2 cut(s) 145, 196
NlaIII CATG 1 cut(s) 138
NlaIV GGNNCC 2 cut(s) 98, 198
NmuCI GTSAC 1 cut(s) 124
PkrI GCNGC 3 cut(s) 106, 181, 241
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
PspN4I GGNNCC 2 cut(s) 98, 198
PspPI GGNCC 1 cut(s) 96
PsuI RGATCY 1 cut(s) 196
SatI GCNGC 3 cut(s) 105, 180, 240
Sau3AI GATC 2 cut(s) 145, 196
Sau96I GGNCC 1 cut(s) 96
ScrFI CCNGG 1 cut(s) 249
SetI ASST 2 cut(s) 192, 231
SinI GGWCC 1 cut(s) 96
SpeI ACTAGT 1 cut(s) 121
SsiI CCGC 1 cut(s) 194
SspMI CTAG 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 247
TseFI GTSAC 1 cut(s) 124
TseI GCWGC 3 cut(s) 104, 179, 239
Tsp45I GTSAC 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 96
XagI CCTNNNNNAGG 1 cut(s) 233
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.