Rh7BG090400

subtilisin-like protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0016592
Physical Location & Seq
Forward (+)
6690782 .. 6691132
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG090400.1

Sequence Viewer

Length: 351 bp
ATGGGAACACATGACTACATAAAATACCTTTGTGCTGTTGGCTACAACACCACAGCTATCTCACAGCTTGTTGGAAAAATCACAGCATGCTCCATTACTTCCATTCTCGATGTGGACTTACCATCCATTACAATTCCAAAACTAAGAAAGCCAATAACACTCACTAGAAGTGTATCGAATGTTGGTCCTGTCAACTCGATATATAAAGCACAAATTGACCCTCCTCCAGGCATATATGTAGCTGTAAGACCAGTTACATTGGTCTTCAACTCCACAGTTGAGACGATGTCTTTCACGGTTACAGTTTCCACCACCCATGAACTGAACACTATTACTACTTCGGAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

116

Amino Acids

12.47

Weight (kDa)

7.78

Isoelectric Point (pI)

27.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 38 - 108 8.5e-17 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016592)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G32980
malus_domestica MD14G1139200.v1.1
pyrus_communis pycom14g11490
rosa_chinensis RchiOBHm_Chr5g0002201
rosa_multiflora Rmu_sc0001492.1_g000003
rosa_roxburghii Rroxscaffold_3G00267180
rosa_rugosa Rorug06G0483500
rosa_samantha Rh5AG017200 Rh7AG088600 Rh7BG090000 Rh7BG090400 Rh7CG089200 Rh7CG089400 Rh7DG090800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 1 cut(s) 268
AjnI CCWGG 1 cut(s) 226
AluBI AGCT 3 cut(s) 56, 67, 242
AluI AGCT 3 cut(s) 56, 67, 242
Alw26I GTCTC 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 185
AvaII GGWCC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 256
BccI CCATC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 228
BcoDI GTCTC 1 cut(s) 275
BfaI CTAG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 228
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 228
BpiI GAAGAC 1 cut(s) 256
BpmI CTGGAG 1 cut(s) 210
Bsc4I CCNNNNNNNGG 1 cut(s) 227
Bse1I ACTGG 1 cut(s) 251
BseBI CCWGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 227
BseNI ACTGG 1 cut(s) 251
BseRI GAGGAG 1 cut(s) 213
BslI CCNNNNNNNGG 1 cut(s) 227
BsmAI GTCTC 1 cut(s) 275
BsmBI CGTCTC 1 cut(s) 275
BsrI ACTGG 1 cut(s) 251
Bst2UI CCWGG 1 cut(s) 228
Bst4CI ACNGT 3 cut(s) 277, 298, 304
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 143
BstENI CCTNNNNNAGG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 275
BstNI CCWGG 1 cut(s) 228
BstNSI RCATGY 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 226
BstV2I GAAGAC 1 cut(s) 256
BtsCI GGATG 1 cut(s) 122
Cac8I GCNNGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 185
CviAII CATG 3 cut(s) 11, 87, 317
CviJI RGCY 6 cut(s) 42, 56, 67, 151, 242, 347
CviKI_1 RGCY 6 cut(s) 42, 56, 67, 151, 242, 347
DdeI CTNAG 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 185
EcoNI CCTNNNNNAGG 1 cut(s) 225
EcoRII CCWGG 1 cut(s) 226
Esp3I CGTCTC 1 cut(s) 275
FaeI CATG 3 cut(s) 14, 90, 320
FaiI YATR 9 cut(s) 12, 20, 88, 202, 204, 233, 235, 237, 318
FatI CATG 3 cut(s) 10, 86, 316
FokI GGATG 1 cut(s) 109
FspBI CTAG 1 cut(s) 165
GsuI CTGGAG 1 cut(s) 210
Hin1II CATG 3 cut(s) 14, 90, 320
HincII GTYRAC 1 cut(s) 193
HindII GTYRAC 1 cut(s) 193
Hpy166II GTNNAC 2 cut(s) 115, 193
Hpy188I TCNGA 1 cut(s) 343
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 115, 193
HpyCH4III ACNGT 3 cut(s) 277, 298, 304
HpyF3I CTNAG 1 cut(s) 143
Hsp92II CATG 3 cut(s) 14, 90, 320
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 4 cut(s) 201, 213, 240, 264
MaeI CTAG 1 cut(s) 165
MaeIII GTNAC 2 cut(s) 253, 298
MboII GAAGA 1 cut(s) 256
MluCI AATT 2 cut(s) 132, 213
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 2 cut(s) 231, 234
MspR9I CCNGG 1 cut(s) 228
MvaI CCWGG 1 cut(s) 228
NlaIII CATG 3 cut(s) 14, 90, 320
NspI RCATGY 1 cut(s) 90
PaeI GCATGC 1 cut(s) 90
PflFI GACNNNGTC 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 226
PspGI CCWGG 1 cut(s) 226
PspPI GGNCC 1 cut(s) 185
PsyI GACNNNGTC 1 cut(s) 286
Sau96I GGNCC 1 cut(s) 185
ScrFI CCNGG 1 cut(s) 228
SetI ASST 4 cut(s) 30, 58, 69, 244
SinI GGWCC 1 cut(s) 185
SphI GCATGC 1 cut(s) 90
Sse9I AATT 2 cut(s) 132, 213
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 226
TaaI ACNGT 3 cut(s) 277, 298, 304
TaqI TCGA 3 cut(s) 108, 176, 197
TasI AATT 2 cut(s) 132, 213
TspDTI ATGAA 1 cut(s) 333
Tth111I GACNNNGTC 1 cut(s) 286
VpaK11BI GGWCC 1 cut(s) 185
XagI CCTNNNNNAGG 1 cut(s) 225
XceI RCATGY 1 cut(s) 90
XcmI CCANNNNNNNNNTGG 1 cut(s) 109
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.