Rh7CG089400

subtilisin-like protease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
6747586 .. 6748266
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG089400.1

Sequence Viewer

Length: 576 bp
ATGGATGGAGGATTCGCCTTGAGTTCAGGAACATCAATGGCAACTCCCCATATTACAGGCATTGTAGCACTTTTAAAAGCATTGCACCCAGATTGGTCTCCTGCCGCAATCAAATCAGCACTAGTAACAACAGCATGGAAGACTGAACCATTCGGAGAACCTATCTCTTCTGAAGGGTCACTGCAGAACCCAAACAAGGCAGCAAACCCTGGACTCATATATGACATGGGAACACATGACTACATAAAATACCTTTGTGCTGTTGGCTACAACACCACAGCTATCTCACAACTTGTTGGAAAAATCACAGCATGCTCCATTACTTCCATTCTCGATGTGGATTTACCATCCATTACAATTCCAAAACTAAGAAAGCAAATAACACTCACTAGAAGTGTATCGAGTGTTGGTCCTGTCAACTCAATATATAAAGCACAAATTGAGCCTCCTCCAGGCCTATATGTAGCTGTAAGACCAGTTACATTGGTCTTCAACTCCACAGTTGAGACGATGTCTTTCACGGTTACAGTTTCCACCACCCATGAAGTGAACACTATTACTACTTCGGAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

191

Amino Acids

20.21

Weight (kDa)

6.4

Isoelectric Point (pI)

40.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S8 PF00082 3 - 51 1.3e-12 Subtilase family
fn3_6 PF17766 113 - 184 1.5e-15 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016592)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 105
AcuI CTGAAG 1 cut(s) 192
AfiI CCNNNNNNNGG 2 cut(s) 196, 452
AgsI TTSAA 1 cut(s) 493
AhlI ACTAGT 1 cut(s) 121
AjnI CCWGG 2 cut(s) 208, 451
AluBI AGCT 2 cut(s) 281, 467
AluI AGCT 2 cut(s) 281, 467
Alw26I GTCTC 2 cut(s) 102, 500
AoxI GGCC 1 cut(s) 454
ApeKI GCWGC 1 cut(s) 200
AspS9I GGNCC 1 cut(s) 410
AvaII GGWCC 1 cut(s) 410
BbsI GAAGAC 2 cut(s) 146, 481
BbvI GCAGC 1 cut(s) 212
BccI CCATC 1 cut(s) 355
BciT130I CCWGG 2 cut(s) 210, 453
BcoDI GTCTC 2 cut(s) 102, 500
BcuI ACTAGT 1 cut(s) 121
BfaI CTAG 2 cut(s) 122, 390
BfmI CTRYAG 1 cut(s) 182
BisI GCNGC 2 cut(s) 105, 201
BlsI GCNGC 2 cut(s) 106, 202
Bme1390I CCNGG 2 cut(s) 210, 453
Bme18I GGWCC 1 cut(s) 410
BmgT120I GGNCC 1 cut(s) 410
BmrFI CCNGG 2 cut(s) 210, 453
BpiI GAAGAC 2 cut(s) 146, 481
BpmI CTGGAG 1 cut(s) 435
BpuEI CTTGAG 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 208
Bsc4I CCNNNNNNNGG 2 cut(s) 196, 452
Bse1I ACTGG 1 cut(s) 476
Bse3DI GCAATG 1 cut(s) 80
BseBI CCWGG 2 cut(s) 210, 453
BseDI CCNNGG 1 cut(s) 208
BseGI GGATG 2 cut(s) 10, 347
BseLI CCNNNNNNNGG 2 cut(s) 196, 452
BseMI GCAATG 1 cut(s) 80
BseNI ACTGG 1 cut(s) 476
BseRI GAGGAG 1 cut(s) 438
BseXI GCAGC 1 cut(s) 212
BshFI GGCC 1 cut(s) 456
BslI CCNNNNNNNGG 2 cut(s) 196, 452
BsmAI GTCTC 2 cut(s) 102, 500
BsmBI CGTCTC 1 cut(s) 500
BsnI GGCC 1 cut(s) 456
Bso31I GGTCTC 1 cut(s) 102
BspACI CCGC 1 cut(s) 105
BspANI GGCC 1 cut(s) 456
BspMAI CTGCAG 1 cut(s) 186
BspTNI GGTCTC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 80
BsrI ACTGG 1 cut(s) 476
BssECI CCNNGG 1 cut(s) 208
Bst2UI CCWGG 2 cut(s) 210, 453
Bst4CI ACNGT 3 cut(s) 502, 523, 529
Bst6I CTCTTC 1 cut(s) 172
BstC8I GCNNGC 1 cut(s) 313
BstDEI CTNAG 1 cut(s) 368
BstENI CCTNNNNNAGG 1 cut(s) 450
BstF5I GGATG 2 cut(s) 10, 347
BstMAI GTCTC 2 cut(s) 102, 500
BstNI CCWGG 2 cut(s) 210, 453
BstNSI RCATGY 1 cut(s) 315
BstSCI CCNGG 2 cut(s) 208, 451
BstSFI CTRYAG 1 cut(s) 182
BstV1I GCAGC 1 cut(s) 212
BstV2I GAAGAC 2 cut(s) 146, 481
BsuRI GGCC 1 cut(s) 456
BtsCI GGATG 2 cut(s) 10, 347
BtsI GCAGTG 1 cut(s) 179
BtsIMutI CAGTG 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 313
Cfr13I GGNCC 1 cut(s) 410
CviAII CATG 5 cut(s) 135, 226, 236, 312, 542
CviJI RGCY 6 cut(s) 267, 281, 445, 456, 467, 572
CviKI_1 RGCY 6 cut(s) 267, 281, 445, 456, 467, 572
DdeI CTNAG 1 cut(s) 368
DraI TTTAAA 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 172
EarI CTCTTC 1 cut(s) 172
Eco147I AGGCCT 1 cut(s) 456
Eco31I GGTCTC 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 410
Eco57I CTGAAG 1 cut(s) 192
EcoNI CCTNNNNNAGG 1 cut(s) 450
EcoRII CCWGG 2 cut(s) 208, 451
Esp3I CGTCTC 1 cut(s) 500
FaeI CATG 5 cut(s) 138, 229, 239, 315, 545
FatI CATG 5 cut(s) 134, 225, 235, 311, 541
Fnu4HI GCNGC 2 cut(s) 105, 201
FokI GGATG 2 cut(s) 17, 334
Fsp4HI GCNGC 2 cut(s) 105, 201
FspBI CTAG 2 cut(s) 122, 390
GluI GCNGC 2 cut(s) 105, 201
GsuI CTGGAG 1 cut(s) 435
HaeIII GGCC 1 cut(s) 456
Hin1II CATG 5 cut(s) 138, 229, 239, 315, 545
HincII GTYRAC 1 cut(s) 418
HindII GTYRAC 1 cut(s) 418
HinfI GANTC 2 cut(s) 12, 213
Hpy166II GTNNAC 2 cut(s) 418, 550
Hpy188I TCNGA 3 cut(s) 155, 172, 568
Hpy188III TCNNGA 2 cut(s) 27, 332
Hpy8I GTNNAC 2 cut(s) 418, 550
HpyAV CCTTC 1 cut(s) 167
HpyCH4III ACNGT 3 cut(s) 502, 523, 529
HpyCH4V TGCA 2 cut(s) 85, 184
HpyF3I CTNAG 1 cut(s) 368
Hsp92II CATG 5 cut(s) 138, 229, 239, 315, 545
LmnI GCTCC 1 cut(s) 320
Lsp1109I GCAGC 1 cut(s) 212
MaeI CTAG 2 cut(s) 122, 390
MaeIII GTNAC 4 cut(s) 124, 177, 478, 523
MboII GAAGA 3 cut(s) 151, 159, 481
MluCI AATT 2 cut(s) 357, 438
MlyI GAGTC 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 2 cut(s) 456, 459
MseI TTAA 1 cut(s) 74
MspR9I CCNGG 2 cut(s) 210, 453
MvaI CCWGG 2 cut(s) 210, 453
NlaIII CATG 5 cut(s) 138, 229, 239, 315, 545
NmuCI GTSAC 1 cut(s) 177
NspI RCATGY 1 cut(s) 315
PaeI GCATGC 1 cut(s) 315
PceI AGGCCT 1 cut(s) 456
PfeI GAWTC 1 cut(s) 12
PflFI GACNNNGTC 1 cut(s) 511
PkrI GCNGC 2 cut(s) 106, 202
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
Psp6I CCWGG 2 cut(s) 208, 451
PspGI CCWGG 2 cut(s) 208, 451
PspPI GGNCC 1 cut(s) 410
PstI CTGCAG 1 cut(s) 186
PsyI GACNNNGTC 1 cut(s) 511
SaqAI TTAA 1 cut(s) 74
SatI GCNGC 2 cut(s) 105, 201
Sau96I GGNCC 1 cut(s) 410
SchI GAGTC 1 cut(s) 207
ScrFI CCNGG 2 cut(s) 210, 453
SetI ASST 4 cut(s) 163, 255, 283, 469
SfcI CTRYAG 1 cut(s) 182
SinI GGWCC 1 cut(s) 410
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
SpeI ACTAGT 1 cut(s) 121
SphI GCATGC 1 cut(s) 315
Sse9I AATT 2 cut(s) 357, 438
SseBI AGGCCT 1 cut(s) 456
SsiI CCGC 1 cut(s) 105
SspMI CTAG 2 cut(s) 122, 390
StuI AGGCCT 1 cut(s) 456
StyD4I CCNGG 2 cut(s) 208, 451
TaaI ACNGT 3 cut(s) 502, 523, 529
TaqI TCGA 2 cut(s) 333, 401
TasI AATT 2 cut(s) 357, 438
TauI GCSGC 1 cut(s) 107
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TscAI CASTG 1 cut(s) 186
TseFI GTSAC 1 cut(s) 177
TseI GCWGC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 177
TspDTI ATGAA 1 cut(s) 558
TspRI CASTG 1 cut(s) 186
Tth111I GACNNNGTC 1 cut(s) 511
VpaK11BI GGWCC 1 cut(s) 410
XagI CCTNNNNNAGG 1 cut(s) 450
XceI RCATGY 1 cut(s) 315
XcmI CCANNNNNNNNNTGG 1 cut(s) 334
XspI CTAG 2 cut(s) 122, 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.