MD15G1172100.v1.1

Ribosomal protein L36

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0010220
Physical Location & Seq
Reverse (-)
13354561 .. 13356337
1777 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1172100.v1.1.491

Sequence Viewer

Length: 321 bp
ATGAAGGTGCGTTCATCTGTGAAGAAGATGTGTGAGTTTTGTAAGACTGTGAAGCGTCGTGGGCGTGTTTTTGTGATTTGCACAGCCAATCCCAAGCATAAGCAAAGACAGGGCATGTCGACATTGGCGTATGAAGGCACGGTGTCCTCCCTGTTTGTGGAGACTAGTTCCAAGCAGGAGAACAACTCTGGTCACACCTTGCAGGCAGGTTTGGCCTCTCTGATACCCAAAAAGCCAGAACCCTCTATGCCCTCTATGCCCACCACGATTCTCGGATGGAGGGTGCGCCTGGCATCCATGCTGTCCAGAAACACCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L36

Protein Analysis

107

Amino Acids

11.8

Weight (kDa)

10.6

Isoelectric Point (pI)

65.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L36 PF00444 1 - 38 1.9e-21 Ribosomal protein L36
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 197
AccI GTMKAC 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 157
AhlI ACTAGT 1 cut(s) 164
AjnI CCWGG 1 cut(s) 288
Alw26I GTCTC 1 cut(s) 155
AoxI GGCC 1 cut(s) 213
AspLEI GCGC 1 cut(s) 288
BccI CCATC 1 cut(s) 270
BciT130I CCWGG 1 cut(s) 290
BcoDI GTCTC 1 cut(s) 155
BcuI ACTAGT 1 cut(s) 164
BfaI CTAG 1 cut(s) 165
BfuAI ACCTGC 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 290
BmrFI CCNGG 1 cut(s) 290
BmsI GCATC 1 cut(s) 302
BplI GAGNNNNNCTC 2 cut(s) 170, 202
Bsc4I CCNNNNNNNGG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 290
BseGI GGATG 2 cut(s) 281, 293
BseLI CCNNNNNNNGG 1 cut(s) 157
BshFI GGCC 1 cut(s) 215
BslI CCNNNNNNNGG 1 cut(s) 157
BsmAI GTCTC 1 cut(s) 155
BsnI GGCC 1 cut(s) 215
BspANI GGCC 1 cut(s) 215
BspMI ACCTGC 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 290
Bst4CI ACNGT 2 cut(s) 49, 142
BstC8I GCNNGC 1 cut(s) 204
BstF5I GGATG 2 cut(s) 281, 293
BstHHI GCGC 1 cut(s) 288
BstMAI GTCTC 1 cut(s) 155
BstMWI GCNNNNNNNGC 3 cut(s) 61, 212, 256
BstNI CCWGG 1 cut(s) 290
BstNSI RCATGY 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 288
BsuRI GGCC 1 cut(s) 215
BtsCI GGATG 2 cut(s) 281, 293
BveI ACCTGC 1 cut(s) 197
Cac8I GCNNGC 1 cut(s) 204
CfoI GCGC 1 cut(s) 288
CseI GACGC 1 cut(s) 44
CviAII CATG 2 cut(s) 115, 298
CviJI RGCY 3 cut(s) 86, 215, 235
CviKI_1 RGCY 3 cut(s) 86, 215, 235
EcoRII CCWGG 1 cut(s) 288
FaeI CATG 2 cut(s) 118, 301
FaiI YATR 6 cut(s) 99, 116, 132, 248, 257, 299
FatI CATG 2 cut(s) 114, 297
FblI GTMKAC 1 cut(s) 119
FokI GGATG 2 cut(s) 280, 288
FspBI CTAG 1 cut(s) 165
GlaI GCGC 1 cut(s) 287
HaeIII GGCC 1 cut(s) 215
HgaI GACGC 1 cut(s) 44
HhaI GCGC 1 cut(s) 288
Hin1II CATG 2 cut(s) 118, 301
Hin6I GCGC 1 cut(s) 286
HinP1I GCGC 1 cut(s) 286
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
HinfI GANTC 1 cut(s) 268
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 2 cut(s) 222, 275
Hpy188III TCNNGA 1 cut(s) 306
Hpy8I GTNNAC 1 cut(s) 120
Hpy99I CGWCG 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 128
HpyCH4III ACNGT 2 cut(s) 49, 142
HpyCH4V TGCA 2 cut(s) 81, 202
HpyF10VI GCNNNNNNNGC 3 cut(s) 61, 212, 256
Hsp92II CATG 2 cut(s) 118, 301
HspAI GCGC 1 cut(s) 286
LpnPI CCDG 9 cut(s) 95, 161, 164, 174, 188, 192, 249, 275, 302
LweI GCATC 1 cut(s) 302
MaeI CTAG 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 191
MboII GAAGA 2 cut(s) 34, 37
MluCI AATT 1 cut(s) 316
MnlI CCTC 5 cut(s) 157, 226, 253, 262, 273
MspR9I CCNGG 1 cut(s) 290
MvaI CCWGG 1 cut(s) 290
MwoI GCNNNNNNNGC 3 cut(s) 61, 212, 256
NlaIII CATG 2 cut(s) 118, 301
NmuCI GTSAC 1 cut(s) 191
NspI RCATGY 1 cut(s) 118
PcsI WCGNNNNNNNCGW 1 cut(s) 125
PfeI GAWTC 1 cut(s) 268
Psp6I CCWGG 1 cut(s) 288
PspGI CCWGG 1 cut(s) 288
SalI GTCGAC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 290
SetI ASST 3 cut(s) 9, 200, 211
SfaNI GCATC 1 cut(s) 302
SpeI ACTAGT 1 cut(s) 164
Sse9I AATT 1 cut(s) 316
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 288
TaaI ACNGT 2 cut(s) 49, 142
TaqI TCGA 1 cut(s) 119
TasI AATT 1 cut(s) 316
TfiI GAWTC 1 cut(s) 268
TseFI GTSAC 1 cut(s) 191
Tsp45I GTSAC 1 cut(s) 191
TspDTI ATGAA 2 cut(s) 17, 147
XceI RCATGY 1 cut(s) 118
XmiI GTMKAC 1 cut(s) 119
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.