MD15G1429600.v1.1

Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Key component of the proton channel

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0014087
Physical Location & Seq
Forward (+)
53003296 .. 53003565
270 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1429600.v1.1.491

Sequence Viewer

Length: 270 bp
ATGTTAAACAAAAGCTTTTCCAATCACATCTCGGTCACTTTTACTTTTTTGTTATTTTGTAATCCCAAGGGTATGTTACCTTATAGCTTTACAGTTACAAGTCATTTTCTCATTACTTTGGGTCTCTCATTTTCTATTTTTATTGGCATTACTATAGTGGGATTTCAAAGAAATGGGCTTCATTTTTTAAGCTTCTCATTACTTGCAGGAGTCCCATTGCCGTTGGCACCTGTAAATTTTTTAATGAATGAATCGTATGAGTTGGATTGA

Protein Analysis

90

Amino Acids

9.94

Weight (kDa)

6.81

Isoelectric Point (pI)

22.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_A PF00119 5 - 83 2e-14 ATP synthase A chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 226
AcsI RAATTY 1 cut(s) 235
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 3 cut(s) 15, 87, 192
AluI AGCT 3 cut(s) 15, 87, 192
Alw26I GTCTC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 235
BanI GGYRCC 1 cut(s) 226
BceAI ACGGC 1 cut(s) 205
BcoDI GTCTC 1 cut(s) 128
BfmI CTRYAG 1 cut(s) 153
BmiI GGNNCC 1 cut(s) 228
BsaI GGTCTC 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 66
Bse3DI GCAATG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 215
BshNI GGYRCC 1 cut(s) 226
BslFI GGGAC 1 cut(s) 197
BsmAI GTCTC 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 197
Bso31I GGTCTC 1 cut(s) 128
BspLI GGNNCC 1 cut(s) 228
BspT107I GGYRCC 1 cut(s) 226
BspTNI GGTCTC 1 cut(s) 128
BsrDI GCAATG 1 cut(s) 215
BssECI CCNNGG 1 cut(s) 66
BssT1I CCWWGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 153
CviJI RGCY 4 cut(s) 15, 87, 178, 192
CviKI_1 RGCY 4 cut(s) 15, 87, 178, 192
Eco130I CCWWGG 1 cut(s) 66
Eco31I GGTCTC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaiI YATR 4 cut(s) 74, 84, 155, 258
FaqI GGGAC 1 cut(s) 197
HindIII AAGCTT 2 cut(s) 13, 190
HinfI GANTC 2 cut(s) 210, 251
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 206
LpnPI CCDG 2 cut(s) 192, 243
MaeIII GTNAC 3 cut(s) 34, 75, 94
MluCI AATT 1 cut(s) 235
MlyI GAGTC 1 cut(s) 219
MmeI TCCRAC 1 cut(s) 243
MseI TTAA 3 cut(s) 5, 188, 242
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 251
PleI GAGTC 1 cut(s) 218
PpsI GAGTC 1 cut(s) 218
PspN4I GGNNCC 1 cut(s) 228
SaqAI TTAA 3 cut(s) 5, 188, 242
SchI GAGTC 1 cut(s) 219
SetI ASST 5 cut(s) 17, 82, 89, 194, 232
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 6 cut(s) 43, 79, 111, 215, 219, 242
Sse9I AATT 1 cut(s) 235
StyI CCWWGG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 94
TaqII GACCGA 1 cut(s) 22
TasI AATT 1 cut(s) 235
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 3 cut(s) 5, 188, 242
Tru9I TTAA 3 cut(s) 5, 188, 242
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 3 cut(s) 170, 260, 264
XapI RAATTY 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.