MD16G1201900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
18379392 .. 18379742
351 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1201900.v1.1.491

Sequence Viewer

Length: 231 bp
ATGGGAAATGAGATGGGTAACAACAACACATCAGGTTTGAGAGATGAAGAGAACACAACAGTTGGTGAAGTTGCCGATAAACCTTTGGCAAAAACTACTCTTGCAAATGACACGAAAGAAGAAAACGTAGTACCGGAAGATGAAGGAAAAGATTTTCATGAAAACATTACCAACTTGGCTTCCGATGATCCAAAGAGAATACAAGATACTTGTGTTGATGATCAGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.34

Weight (kDa)

4.11

Isoelectric Point (pI)

20.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AfaI GTAC 1 cut(s) 132
AlwI GGATC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 77
BaeI ACNNNNGTAYC 2 cut(s) 198, 231
BccI CCATC 1 cut(s) 7
BclI TGATCA 1 cut(s) 220
BsaWI WCCGGW 1 cut(s) 133
BsiSI CCGG 1 cut(s) 134
Bsp143I GATC 2 cut(s) 187, 220
BspHI TCATGA 1 cut(s) 157
BspPI GGATC 1 cut(s) 182
BssMI GATC 2 cut(s) 187, 220
Bst4CI ACNGT 1 cut(s) 61
Bst6I CTCTTC 1 cut(s) 42
BstKTI GATC 2 cut(s) 190, 223
BstMBI GATC 2 cut(s) 187, 220
CciI TCATGA 1 cut(s) 157
Csp6I GTAC 1 cut(s) 131
CviAII CATG 1 cut(s) 158
CviJI RGCY 1 cut(s) 179
CviKI_1 RGCY 1 cut(s) 179
CviQI GTAC 1 cut(s) 131
DpnI GATC 2 cut(s) 189, 222
DpnII GATC 2 cut(s) 187, 220
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
FaeI CATG 1 cut(s) 161
FaiI YATR 2 cut(s) 159, 229
FatI CATG 1 cut(s) 157
FbaI TGATCA 1 cut(s) 220
HapII CCGG 1 cut(s) 134
Hin1II CATG 1 cut(s) 161
HpaII CCGG 1 cut(s) 134
HphI GGTGA 1 cut(s) 77
Hpy188I TCNGA 2 cut(s) 184, 225
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 104
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 1 cut(s) 161
Ksp22I TGATCA 1 cut(s) 220
Kzo9I GATC 2 cut(s) 187, 220
LpnPI CCDG 2 cut(s) 18, 147
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 17
MalI GATC 2 cut(s) 189, 222
MboI GATC 2 cut(s) 187, 220
MboII GAAGA 3 cut(s) 59, 131, 149
MspI CCGG 1 cut(s) 134
NdeII GATC 2 cut(s) 187, 220
NlaIII CATG 1 cut(s) 161
PagI TCATGA 1 cut(s) 157
RsaI GTAC 1 cut(s) 132
RsaNI GTAC 1 cut(s) 131
Sau3AI GATC 2 cut(s) 187, 220
SetI ASST 3 cut(s) 37, 85, 129
SgeI CNNG 8 cut(s) 45, 113, 124, 146, 170, 187, 215, 222
TaaI ACNGT 1 cut(s) 61
TaiI ACGT 1 cut(s) 129
TspDTI ATGAA 4 cut(s) 60, 146, 156, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.