MD17G1059100.v1.1

exocyst complex component

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
4809777 .. 4811716
1940 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1059100.v1.1.491

Sequence Viewer

Length: 321 bp
ATGAAATTGGGTGAGTCTGTGAAGGCAACATTTAGTAACCCTGTTGCTGGAGGAGGAATACATCCTCTCACCAAATATGTGATGAATTACTTGAGGATTCTCACAGACTATGGAGAGACCCTTAATTTTCTCTTTGAGGACAGTGCTGATGCTGATTCCATTTCGCTGTCGCCTGACACGAGTCCTACCTCAGACGAGGCACTGATTCTCCAGGCAGAATTTTCCCAATGGTTCGCCACTTCCGATCACTTACTTCAACTCTGGAAGGCAACCTTGACGAAAAGTCCAGGTTATATAAGGATCCTTCCTTGCACCACGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.67

Weight (kDa)

4.71

Isoelectric Point (pI)

47.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Exo70_C PF03081 4 - 80 9.2e-13 Exo70 exocyst complex subunit C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 295, 308
AcsI RAATTY 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 1 cut(s) 257
AhdI GACNNNNNGTC 1 cut(s) 282
AjnI CCWGG 2 cut(s) 210, 286
Alw26I GTCTC 1 cut(s) 110
AlwI GGATC 2 cut(s) 295, 308
ApoI RAATTY 1 cut(s) 218
AsuHPI GGTGA 2 cut(s) 23, 61
BamHI GGATCC 1 cut(s) 300
BauI CACGAG 1 cut(s) 178
BciT130I CCWGG 2 cut(s) 212, 288
BcoDI GTCTC 1 cut(s) 110
Bme1390I CCNGG 2 cut(s) 212, 288
BmeRI GACNNNNNGTC 1 cut(s) 282
BmiI GGNNCC 1 cut(s) 302
BmrFI CCNGG 2 cut(s) 212, 288
BmsI GCATC 1 cut(s) 139
BoxI GACNNNNGTC 1 cut(s) 180
BpmI CTGGAG 2 cut(s) 69, 194
BpuEI CTTGAG 1 cut(s) 112
BsaAI YACGTR 1 cut(s) 318
BsaI GGTCTC 1 cut(s) 110
BsaXI ACNNNNNCTCC 2 cut(s) 192, 222
Bsc4I CCNNNNNNNGG 1 cut(s) 47
BseBI CCWGG 2 cut(s) 212, 288
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 204
BseRI GAGGAG 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 47
BsmAI GTCTC 1 cut(s) 110
Bso31I GGTCTC 1 cut(s) 110
Bsp143I GATC 2 cut(s) 244, 300
BspCNI CTCAG 1 cut(s) 203
BspLI GGNNCC 1 cut(s) 302
BspPI GGATC 2 cut(s) 295, 308
BspTNI GGTCTC 1 cut(s) 110
BssMI GATC 2 cut(s) 244, 300
BssSI CACGAG 1 cut(s) 178
Bst2BI CACGAG 1 cut(s) 178
Bst2UI CCWGG 2 cut(s) 212, 288
Bst4CI ACNGT 1 cut(s) 143
BstBAI YACGTR 1 cut(s) 318
BstDEI CTNAG 1 cut(s) 190
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 247, 303
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 2 cut(s) 244, 300
BstNI CCWGG 2 cut(s) 212, 288
BstPAI GACNNNNGTC 1 cut(s) 180
BstSCI CCNGG 2 cut(s) 210, 286
BstX2I RGATCY 1 cut(s) 300
BstYI RGATCY 1 cut(s) 300
BtsCI GGATG 1 cut(s) 61
BtsIMutI CAGTG 2 cut(s) 148, 200
DdeI CTNAG 1 cut(s) 190
DpnI GATC 2 cut(s) 246, 302
DpnII GATC 2 cut(s) 244, 300
DriI GACNNNNNGTC 1 cut(s) 282
Eam1105I GACNNNNNGTC 1 cut(s) 282
Eco31I GGTCTC 1 cut(s) 110
EcoRII CCWGG 2 cut(s) 210, 286
FaiI YATR 4 cut(s) 78, 111, 294, 296
FalI AAGNNNNNCTT 2 cut(s) 257, 289
FokI GGATG 1 cut(s) 48
GsuI CTGGAG 2 cut(s) 69, 194
HinfI GANTC 5 cut(s) 14, 97, 155, 181, 205
HphI GGTGA 2 cut(s) 23, 61
Hpy188I TCNGA 2 cut(s) 193, 244
Hpy188III TCNNGA 1 cut(s) 262
HpyAV CCTTC 3 cut(s) 16, 259, 314
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 317
HpyCH4V TGCA 1 cut(s) 312
HpyF3I CTNAG 1 cut(s) 190
HpySE526I ACGT 1 cut(s) 317
Kzo9I GATC 2 cut(s) 244, 300
LpnPI CCDG 8 cut(s) 33, 54, 186, 197, 224, 247, 273, 300
LweI GCATC 1 cut(s) 139
MaeII ACGT 1 cut(s) 317
MaeIII GTNAC 1 cut(s) 35
MalI GATC 2 cut(s) 246, 302
MboI GATC 2 cut(s) 244, 300
MflI RGATCY 1 cut(s) 300
MluCI AATT 4 cut(s) 5, 85, 124, 218
MlyI GAGTC 2 cut(s) 23, 190
MnlI CCTC 7 cut(s) 44, 47, 75, 87, 130, 190, 199
MseI TTAA 1 cut(s) 123
MspR9I CCNGG 2 cut(s) 212, 288
MvaI CCWGG 2 cut(s) 212, 288
NdeII GATC 2 cut(s) 244, 300
NlaIV GGNNCC 1 cut(s) 302
PcsI WCGNNNNNNNCGW 2 cut(s) 176, 240
PfeI GAWTC 3 cut(s) 97, 155, 205
PleI GAGTC 2 cut(s) 22, 189
PpsI GAGTC 2 cut(s) 22, 189
Ppu21I YACGTR 1 cut(s) 318
PshAI GACNNNNGTC 1 cut(s) 180
Psp6I CCWGG 2 cut(s) 210, 286
PspGI CCWGG 2 cut(s) 210, 286
PspN4I GGNNCC 1 cut(s) 302
PsuI RGATCY 1 cut(s) 300
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 2 cut(s) 244, 300
SchI GAGTC 2 cut(s) 23, 190
ScrFI CCNGG 2 cut(s) 212, 288
SetI ASST 4 cut(s) 191, 275, 292, 320
SfaNI GCATC 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
Sse9I AATT 4 cut(s) 5, 85, 124, 218
StyD4I CCNGG 2 cut(s) 210, 286
TaaI ACNGT 1 cut(s) 143
TaiI ACGT 1 cut(s) 320
TasI AATT 4 cut(s) 5, 85, 124, 218
TfiI GAWTC 3 cut(s) 97, 155, 205
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TscAI CASTG 2 cut(s) 148, 207
TspDTI ATGAA 2 cut(s) 17, 98
TspRI CASTG 2 cut(s) 148, 207
XapI RAATTY 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.