Rorug02G0518500

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
64985526 .. 64986351
826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0518500.1

Sequence Viewer

Length: 174 bp
ATGGCTAGTTTTGAGCTTTTCGGGTTGACAAATTCATCTTTCATTCGGGGAGTGAGGCCCTTGCTTCAGGTTCATATAAATAGCTTTAACAGCGTGCAAAGATGGGTAAAGTCTTCAGAAGCTGATTTCGACGAATTTTGTCCGGATATGGCTATGGAGCAACCCTTTTGTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.56

Weight (kDa)

4.7

Isoelectric Point (pI)

55.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 142
AcsI RAATTY 2 cut(s) 31, 134
AcuI CTGAAG 2 cut(s) 50, 99
AluBI AGCT 3 cut(s) 16, 84, 122
AluI AGCT 3 cut(s) 16, 84, 122
AlwNI CAGNNNCTG 1 cut(s) 122
Aor13HI TCCGGA 1 cut(s) 142
AoxI GGCC 1 cut(s) 56
ApoI RAATTY 2 cut(s) 31, 134
AspS9I GGNCC 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 105
BccI CCATC 1 cut(s) 96
BfaI CTAG 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 105
BsaWI WCCGGW 1 cut(s) 142
BseAI TCCGGA 1 cut(s) 142
BshFI GGCC 1 cut(s) 58
BsiSI CCGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 58
Bsp13I TCCGGA 1 cut(s) 142
BspANI GGCC 1 cut(s) 58
BspEI TCCGGA 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 95
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstV2I GAAGAC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 95
CaiI CAGNNNCTG 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 57
CviJI RGCY 6 cut(s) 5, 16, 58, 84, 122, 152
CviKI_1 RGCY 6 cut(s) 5, 16, 58, 84, 122, 152
Eco57I CTGAAG 2 cut(s) 50, 99
EcoO109I RGGNCCY 1 cut(s) 57
FaiI YATR 4 cut(s) 75, 77, 149, 155
FspBI CTAG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 58
HapII CCGG 1 cut(s) 143
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HpaII CCGG 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 143
Hpy8I GTNNAC 1 cut(s) 27
Hpy99I CGWCG 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
Kpn2I TCCGGA 1 cut(s) 142
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 2 cut(s) 53, 156
MaeI CTAG 1 cut(s) 6
MboII GAAGA 1 cut(s) 105
MluCI AATT 2 cut(s) 31, 134
MnlI CCTC 1 cut(s) 48
MroI TCCGGA 1 cut(s) 142
MseI TTAA 1 cut(s) 87
MspI CCGG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 57
PstNI CAGNNNCTG 1 cut(s) 122
SaqAI TTAA 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 57
SetI ASST 4 cut(s) 18, 72, 86, 124
SgeI CNNG 7 cut(s) 18, 34, 59, 73, 80, 106, 155
Sse9I AATT 2 cut(s) 31, 134
SspMI CTAG 1 cut(s) 6
TaqI TCGA 1 cut(s) 129
TasI AATT 2 cut(s) 31, 134
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TspDTI ATGAA 3 cut(s) 24, 31, 62
XapI RAATTY 2 cut(s) 31, 134
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.