Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8505119.1

Orthogroup ID

OG0009068

Physical Location & Seq

Genomic Coordinates Reverse (-)

1277 .. 3094

Gene Structure 1818 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8505119.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1818 bp

atgactaataggagcacattgaatgagatacaggtggaggactttggtgacattgaagttcgccttacttcgattcaggataaggtcttggggtgggaggcggatcagactatgatatgggattcgagtgcaaatgaggcgaatgagtacttgaacacggtggaggaggctcaccagctgattgaaagtttggagagtttgtgtctgagtaaagatgatgaaaagtatgagctgttacacaaggcgaatgatgttcttcaaacggcgatgattaggctggaggatgagttcaggtacatgcttgttcagaacaggcagccgtgtgcaccggagcacatgtcttttcgttcatgcgaagaggatgctgtggatgagaactcattgatgtcttttggggatgactcaattgaggactcatttcaaagggatagtgttagccgagcctctgaggattccatcattgacttggttcgcccggaagttattcctgacctcaggagcattgcaaatatgatgttcaattgcaactatgatcaggaatgtacccaagcttataccaacctccgaagggatgccttggatgagtgtctctcatatctagaaattcagaaactgagcattgaggatgtgcggaagatggagtgggtttctttgaattccaaaatcagaagatgggtctgggttatgaagattttcgtgcggatttatctggctagcgagaagtggctcagtgaacagatttttgaggagcttggacctgttcggctagattgttttgttgaggcatcaaaggcttcaatactgcagcttctcaatttcgccgaagccatgtctatcggccctcaccagccagaaaagttggttcgcattcttgacatgtatgaggtgctagcggatgttcttcccgatatagatgctttatactttggtgaggctggttcttctgtaagcatggagtgtcatgatgtcctgctgagattgggtgattctgtgaaggcaacagttattgaatttgagaatgccattgcatcaaacccttccactaaccctgtttcaggtgggggtatacacccgctgactagatatgtgatgaattacatgaggactcttacagactatggtcagacccttgatctgcttctcaaggactgcgatgaaggcgatcccatttcgttgtctcctgacactagtccaactaaagaagaggagaacaaaagcactgattcttcaggcagaaaatccccaatggctcaccagttcctatcatttgcttcaagtctggaagccaatcttgatgagaagtcaaagttatataaggatgcttctttgcaacacgtctttttgatgaacaatatacattacatggctcagaaggttaaaggggcagaattgaggcttatctttggagatgattggattagaaagcacaacaggaaatttcaacagcatgcgatgagctaccagagagctagttggagttacatcctttctttgctaaaagaggagggcatacaaaatcctgggtcaaattctatctcaaaaagccttctcaaggaaaggctccgcagcttttatcttacttttgaggagatatacaaggtccagtcggcatggctcattccggatcctcagcttcgagaagacttgcaaatctcgacatcccttaatgtgatccaagcttacaggacatttgtgggaagacactccaatgacataagtgacaagctcatcaagtacagtgctgatgacatggagaattacctcatggatctctttgaaggttcctcaaaattattacaaaattccagccggaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006810 GO:0006887 GO:0008150 GO:0009987 GO:0016192 GO:0032940 GO:0046903 GO:0051179 GO:0051234

KEGG Pathways

Metabolic & Signaling

ko04910 map04910

Pfam Domains

Protein Families

Exo70

Protein Analysis

605

Amino Acids

69.5

Weight (kDa)

4.75

Isoelectric Point (pI)

55.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009068)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G29400
fragaria_vesca	FvH4_6g46900
malus_domestica	MD09G1066500.v1.1 MD17G1059100.v1.1 MD17G1059400.v1.1 MD17G1059500.v1.1 MD17G1059600.v1.1
prunus_persica	Prupe.3G255100_v2.0.a1 Prupe.3G255100_v2.0.a1
pyrus_communis	pycom111g05580 pycom14g07030 pycom17g05930
rosa_chinensis	RchiOBHm_Chr2g0165871
rosa_laevigata	RLG00000021563
rosa_multiflora	Rmu_co8505119.1_g000002
rosa_roxburghii	Rroxscaffold_2G00085400
rosa_rugosa	Rorug02G0518500
rosa_samantha	Rh2AG584400 Rh2BG596200 Rh2CG567100 Rh2DG606000
rosa_wichuraiana	Rw2G048720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	1066
AccIII	TCCGGA	1 cut(s)	1621
AciI	CCGC	6 cut(s)	101, 631, 700, 893, 1073, 1564
AclWI	GGATC	6 cut(s)	111, 1157, 1619, 1632, 1666, 1776
AcsI	RAATTY	6 cut(s)	603, 655, 1010, 1436, 1528, 1801
AcuI	CTGAAG	1 cut(s)	1212
AfaI	GTAC	4 cut(s)	149, 296, 544, 1736
AfiI	CCNNNNNNNGG	4 cut(s)	568, 1055, 1552, 1812
AflIII	ACRYGT	3 cut(s)	336, 876, 1333
AhlI	ACTAGT	1 cut(s)	1187
AjiI	CACGTC	1 cut(s)	1336
AjnI	CCWGG	1 cut(s)	1519
AloI	GAACNNNNNNTCC	2 cut(s)	272, 304
Alw21I	GWGCWC	3 cut(s)	17, 328, 336
Alw26I	GTCTC	2 cut(s)	593, 1182
Alw44I	GTGCAC	1 cut(s)	324
AlwI	GGATC	6 cut(s)	111, 1157, 1619, 1632, 1666, 1776
AlwNI	CAGNNNCTG	1 cut(s)	613
Aor13HI	TCCGGA	1 cut(s)	1621
AoxI	GGCC	1 cut(s)	838
ApaLI	GTGCAC	1 cut(s)	324
ApeKI	GCWGC	3 cut(s)	316, 805, 1566
ApoI	RAATTY	6 cut(s)	603, 655, 1010, 1436, 1528, 1801
Asp700I	GAANNNNTTC	2 cut(s)	483, 692
AspS9I	GGNCC	3 cut(s)	755, 839, 1600
AsuC2I	CCSGG	1 cut(s)	476
AsuHPI	GGTGA	6 cut(s)	59, 164, 836, 941, 995, 1244
AsuNHI	GCTAGC	2 cut(s)	713, 889
AvaII	GGWCC	2 cut(s)	755, 1600
AxyI	CCTNAGG	1 cut(s)	494
BaeGI	GKGCMC	1 cut(s)	328
BamHI	GGATCC	1 cut(s)	1624
BbsI	GAAGAC	2 cut(s)	1647, 1705
Bbv12I	GWGCWC	3 cut(s)	17, 328, 336
BbvCI	CCTCAGC	1 cut(s)	1629
BbvI	GCAGC	3 cut(s)	328, 817, 1578
BccI	CCATC	3 cut(s)	464, 631, 666
BceAI	ACGGC	2 cut(s)	279, 304
BcgI	CGANNNNNNTGC	4 cut(s)	344, 378, 896, 930
BciT130I	CCWGG	1 cut(s)	1521
BclI	TGATCA	1 cut(s)	532
BcnI	CCSGG	1 cut(s)	476
BcoDI	GTCTC	2 cut(s)	593, 1182
BcuI	ACTAGT	1 cut(s)	1187
BfaI	CTAG	7 cut(s)	599, 714, 767, 890, 1080, 1188, 1470
BfmI	CTRYAG	1 cut(s)	803
BisI	GCNGC	3 cut(s)	317, 806, 1567
BlsI	GCNGC	3 cut(s)	318, 807, 1568
BmcAI	AGTACT	1 cut(s)	149
Bme1390I	CCNGG	2 cut(s)	476, 1521
Bme18I	GGWCC	2 cut(s)	755, 1600
BmgBI	CACGTC	1 cut(s)	1336
BmgT120I	GGNCC	3 cut(s)	755, 839, 1600
BmiI	GGNNCC	3 cut(s)	1562, 1626, 1783
BmrFI	CCNGG	2 cut(s)	476, 1521
BmsI	GCATC	6 cut(s)	352, 562, 794, 904, 1037, 1309
BmtI	GCTAGC	2 cut(s)	717, 893
BoxI	GACNNNNGTC	2 cut(s)	1119, 1188
BpiI	GAAGAC	2 cut(s)	1647, 1705
BplI	GAGNNNNNCTC	2 cut(s)	575, 607
BpmI	CTGGAG	1 cut(s)	299
Bpu10I	CCTNAGC	1 cut(s)	1629
BpuEI	CTTGAG	2 cut(s)	1127, 1535
BpuMI	CCSGG	1 cut(s)	476
BsaJI	CCNNGG	2 cut(s)	576, 1520
BsaWI	WCCGGW	2 cut(s)	328, 1621
BsaXI	ACNNNNNCTCC	6 cut(s)	185, 215, 272, 302, 323, 353
Bsc4I	CCNNNNNNNGG	4 cut(s)	568, 1055, 1552, 1812
Bse1I	ACTGG	2 cut(s)	1255, 1603
Bse21I	CCTNAGG	1 cut(s)	494
Bse3DI	GCAATG	2 cut(s)	501, 1023
BseAI	TCCGGA	1 cut(s)	1621
BseBI	CCWGG	1 cut(s)	1521
BseDI	CCNNGG	2 cut(s)	576, 1520
BseLI	CCNNNNNNNGG	4 cut(s)	568, 1055, 1552, 1812
BseMI	GCAATG	2 cut(s)	501, 1023
BseMII	CTCAG	8 cut(s)	197, 438, 508, 605, 742, 965, 1382, 1643
BseNI	ACTGG	2 cut(s)	1255, 1603
BseRI	GAGGAG	5 cut(s)	179, 761, 1220, 1517, 1601
BseSI	GKGCMC	1 cut(s)	328
BseXI	GCAGC	3 cut(s)	328, 817, 1578
BshFI	GGCC	1 cut(s)	840
BsiHKAI	GWGCWC	3 cut(s)	17, 328, 336
BsiSI	CCGG	4 cut(s)	329, 476, 1622, 1810
BslI	CCNNNNNNNGG	4 cut(s)	568, 1055, 1552, 1812
BsmAI	GTCTC	2 cut(s)	593, 1182
BsmI	GAATGC	2 cut(s)	867, 1024
BsnI	GGCC	1 cut(s)	840
Bsp1286I	GDGCHC	3 cut(s)	17, 328, 336
Bsp13I	TCCGGA	1 cut(s)	1621
Bsp143I	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
BspACI	CCGC	6 cut(s)	101, 631, 700, 893, 1073, 1564
BspANI	GGCC	1 cut(s)	840
BspCNI	CTCAG	8 cut(s)	198, 439, 507, 606, 741, 966, 1381, 1642
BspEI	TCCGGA	1 cut(s)	1621
BspHI	TCATGA	1 cut(s)	961
BspLI	GGNNCC	3 cut(s)	1562, 1626, 1783
BspMAI	CTGCAG	1 cut(s)	807
BspOI	GCTAGC	2 cut(s)	717, 893
BspPI	GGATC	6 cut(s)	111, 1157, 1619, 1632, 1666, 1776
BsrDI	GCAATG	2 cut(s)	501, 1023
BsrI	ACTGG	2 cut(s)	1255, 1603
BssECI	CCNNGG	2 cut(s)	576, 1520
BssMI	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
BssNAI	GTATAC	1 cut(s)	1067
BssT1I	CCWWGG	1 cut(s)	576
Bst1107I	GTATAC	1 cut(s)	1067
Bst2UI	CCWGG	1 cut(s)	1521
Bst4CI	ACNGT	3 cut(s)	160, 1003, 1739
Bst6I	CTCTTC	2 cut(s)	351, 1197
BstC8I	GCNNGC	3 cut(s)	715, 891, 1449
BstDEI	CTNAG	8 cut(s)	206, 447, 494, 614, 728, 974, 1368, 1629
BstENI	CCTNNNNNAGG	2 cut(s)	1053, 1550
BstKTI	GATC	7 cut(s)	106, 535, 1135, 1165, 1627, 1674, 1771
BstMAI	GTCTC	2 cut(s)	593, 1182
BstMBI	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
BstMWI	GCNNNNNNNGC	3 cut(s)	137, 791, 1158
BstNI	CCWGG	1 cut(s)	1521
BstNSI	RCATGY	4 cut(s)	301, 340, 880, 1451
BstPAI	GACNNNNGTC	2 cut(s)	1119, 1188
BstSCI	CCNGG	2 cut(s)	474, 1519
BstSFI	CTRYAG	1 cut(s)	803
BstSLI	GKGCMC	1 cut(s)	328
BstV1I	GCAGC	3 cut(s)	328, 817, 1578
BstV2I	GAAGAC	2 cut(s)	1647, 1705
BstX2I	RGATCY	2 cut(s)	1624, 1768
BstYI	RGATCY	2 cut(s)	1624, 1768
BstZ17I	GTATAC	1 cut(s)	1067
Bsu36I	CCTNAGG	1 cut(s)	494
BsuRI	GGCC	1 cut(s)	840
BtgZI	GCGATG	3 cut(s)	281, 1167, 1466
BtrI	CACGTC	1 cut(s)	1336
BtsIMutI	CAGTG	3 cut(s)	736, 1218, 1744
Cac8I	GCNNGC	3 cut(s)	715, 891, 1449
CaiI	CAGNNNCTG	1 cut(s)	613
CciI	TCATGA	1 cut(s)	961
Cfr13I	GGNCC	3 cut(s)	755, 839, 1600
Csp6I	GTAC	4 cut(s)	148, 295, 543, 1735
CviQI	GTAC	4 cut(s)	148, 295, 543, 1735
DdeI	CTNAG	8 cut(s)	206, 447, 494, 614, 728, 974, 1368, 1629
DpnI	GATC	7 cut(s)	105, 534, 1134, 1164, 1626, 1673, 1770
DpnII	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
Eam1104I	CTCTTC	2 cut(s)	351, 1197
EarI	CTCTTC	2 cut(s)	351, 1197
EciI	GGCGGA	1 cut(s)	116
Eco130I	CCWWGG	1 cut(s)	576
Eco47I	GGWCC	2 cut(s)	755, 1600
Eco57I	CTGAAG	1 cut(s)	1212
Eco81I	CCTNAGG	1 cut(s)	494
EcoNI	CCTNNNNNAGG	2 cut(s)	1053, 1550
EcoRI	GAATTC	1 cut(s)	655
EcoRII	CCWGG	1 cut(s)	1519
EcoT14I	CCWWGG	1 cut(s)	576
ErhI	CCWWGG	1 cut(s)	576
FalI	AAGNNNNNCTT	4 cut(s)	48, 80, 1275, 1307
FauI	CCCGC	1 cut(s)	1080
FbaI	TGATCA	1 cut(s)	532
FblI	GTMKAC	1 cut(s)	1066
Fnu4HI	GCNGC	3 cut(s)	317, 806, 1567
Fsp4HI	GCNGC	3 cut(s)	317, 806, 1567
FspBI	CTAG	7 cut(s)	599, 714, 767, 890, 1080, 1188, 1470
GluI	GCNGC	3 cut(s)	317, 806, 1567
GsuI	CTGGAG	1 cut(s)	299
HaeIII	GGCC	1 cut(s)	840
HapII	CCGG	4 cut(s)	329, 476, 1622, 1810
HindIII	AAGCTT	2 cut(s)	549, 1677
HinfI	GANTC	8 cut(s)	73, 122, 401, 413, 452, 986, 1105, 1223
HpaII	CCGG	4 cut(s)	329, 476, 1622, 1810
HphI	GGTGA	6 cut(s)	59, 164, 836, 941, 995, 1244
Hpy166II	GTNNAC	3 cut(s)	326, 734, 1067
Hpy188I	TCNGA	9 cut(s)	108, 207, 309, 448, 566, 609, 668, 1125, 1371
Hpy8I	GTNNAC	3 cut(s)	326, 734, 1067
HpyAV	CCTTC	7 cut(s)	561, 988, 1047, 1151, 1366, 1556, 1772
HpyCH4III	ACNGT	3 cut(s)	160, 1003, 1739
HpyCH4IV	ACGT	1 cut(s)	1335
HpyCH4V	TGCA	8 cut(s)	131, 326, 506, 525, 805, 1028, 1330, 1648
HpyF10VI	GCNNNNNNNGC	3 cut(s)	137, 791, 1158
HpyF3I	CTNAG	8 cut(s)	206, 447, 494, 614, 728, 974, 1368, 1629
HpySE526I	ACGT	1 cut(s)	1335
Kpn2I	TCCGGA	1 cut(s)	1621
Ksp22I	TGATCA	1 cut(s)	532
Kzo9I	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
LmnI	GCTCC	5 cut(s)	12, 331, 498, 748, 1566
Lsp1109I	GCAGC	3 cut(s)	328, 817, 1578
LweI	GCATC	6 cut(s)	352, 562, 794, 904, 1037, 1309
MaeI	CTAG	7 cut(s)	599, 714, 767, 890, 1080, 1188, 1470
MaeII	ACGT	1 cut(s)	1335
MaeIII	GTNAC	4 cut(s)	47, 234, 1478, 1718
MalI	GATC	7 cut(s)	105, 534, 1134, 1164, 1626, 1673, 1770
MboI	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
MfeI	CAATTG	2 cut(s)	405, 520
MflI	RGATCY	2 cut(s)	1624, 1768
MhlI	GDGCHC	3 cut(s)	17, 328, 336
MlyI	GAGTC	3 cut(s)	395, 407, 1099
MmeI	TCCRAC	2 cut(s)	1217, 1454
MroI	TCCGGA	1 cut(s)	1621
MroXI	GAANNNNTTC	2 cut(s)	483, 692
MseI	TTAA	2 cut(s)	1377, 1665
MslI	CAYNNNNRTG	1 cut(s)	1707
MspA1I	CMGCKG	2 cut(s)	178, 1075
MspI	CCGG	4 cut(s)	329, 476, 1622, 1810
MspR9I	CCNGG	2 cut(s)	476, 1521
MunI	CAATTG	2 cut(s)	405, 520
Mva1269I	GAATGC	2 cut(s)	867, 1024
MvaI	CCWGG	1 cut(s)	1521
MwoI	GCNNNNNNNGC	3 cut(s)	137, 791, 1158
NciI	CCSGG	1 cut(s)	476
NdeII	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
NheI	GCTAGC	2 cut(s)	713, 889
NlaIV	GGNNCC	3 cut(s)	1562, 1626, 1783
NmeAIII	GCCGAG	1 cut(s)	464
NmuCI	GTSAC	2 cut(s)	47, 1718
NspI	RCATGY	4 cut(s)	301, 340, 880, 1451
PaeI	GCATGC	1 cut(s)	1451
PagI	TCATGA	1 cut(s)	961
PciI	ACATGT	2 cut(s)	336, 876
PctI	GAATGC	2 cut(s)	867, 1024
PdmI	GAANNNNTTC	2 cut(s)	483, 692
PfeI	GAWTC	5 cut(s)	73, 122, 452, 986, 1223
PkrI	GCNGC	3 cut(s)	318, 807, 1568
PleI	GAGTC	3 cut(s)	395, 407, 1099
PpsI	GAGTC	3 cut(s)	395, 407, 1099
PscI	ACATGT	2 cut(s)	336, 876
PshAI	GACNNNNGTC	2 cut(s)	1119, 1188
Psp6I	CCWGG	1 cut(s)	1519
PspGI	CCWGG	1 cut(s)	1519
PspN4I	GGNNCC	3 cut(s)	1562, 1626, 1783
PspPI	GGNCC	3 cut(s)	755, 839, 1600
PstI	CTGCAG	1 cut(s)	807
PstNI	CAGNNNCTG	1 cut(s)	613
PsuI	RGATCY	2 cut(s)	1624, 1768
PvuII	CAGCTG	1 cut(s)	178
RsaI	GTAC	4 cut(s)	149, 296, 544, 1736
RsaNI	GTAC	4 cut(s)	148, 295, 543, 1735
RseI	CAYNNNNRTG	1 cut(s)	1707
SaqAI	TTAA	2 cut(s)	1377, 1665
SatI	GCNGC	3 cut(s)	317, 806, 1567
Sau3AI	GATC	7 cut(s)	103, 532, 1132, 1162, 1624, 1671, 1768
Sau96I	GGNCC	3 cut(s)	755, 839, 1600
ScaI	AGTACT	1 cut(s)	149
SchI	GAGTC	3 cut(s)	395, 407, 1099
ScrFI	CCNGG	2 cut(s)	476, 1521
SduI	GDGCHC	3 cut(s)	17, 328, 336
SfaNI	GCATC	6 cut(s)	352, 562, 794, 904, 1037, 1309
SfcI	CTRYAG	1 cut(s)	803
SinI	GGWCC	2 cut(s)	755, 1600
SmiMI	CAYNNNNRTG	1 cut(s)	1707
SmlI	CTYRAG	2 cut(s)	1142, 1550
SmoI	CTYRAG	2 cut(s)	1142, 1550
SpeI	ACTAGT	1 cut(s)	1187
SphI	GCATGC	1 cut(s)	1451
SsiI	CCGC	6 cut(s)	101, 631, 700, 893, 1073, 1564
SspMI	CTAG	7 cut(s)	599, 714, 767, 890, 1080, 1188, 1470
StyD4I	CCNGG	2 cut(s)	474, 1519
StyI	CCWWGG	1 cut(s)	576
TaaI	ACNGT	3 cut(s)	160, 1003, 1739
TaiI	ACGT	1 cut(s)	1338
TaqI	TCGA	4 cut(s)	71, 125, 1636, 1655
TatI	WGTACW	2 cut(s)	147, 1734
TfiI	GAWTC	5 cut(s)	73, 122, 452, 986, 1223
Tru1I	TTAA	2 cut(s)	1377, 1665
Tru9I	TTAA	2 cut(s)	1377, 1665
TscAI	CASTG	3 cut(s)	736, 1225, 1744
TseFI	GTSAC	2 cut(s)	47, 1718
TseI	GCWGC	3 cut(s)	316, 805, 1566
Tsp45I	GTSAC	2 cut(s)	47, 1718
TspDTI	ATGAA	6 cut(s)	234, 339, 701, 1106, 1170, 1361
TspRI	CASTG	3 cut(s)	736, 1225, 1744
VneI	GTGCAC	1 cut(s)	324
VpaK11BI	GGWCC	2 cut(s)	755, 1600
XagI	CCTNNNNNAGG	2 cut(s)	1053, 1550
XapI	RAATTY	6 cut(s)	603, 655, 1010, 1436, 1528, 1801
XbaI	TCTAGA	1 cut(s)	598
XceI	RCATGY	4 cut(s)	301, 340, 880, 1451
XcmI	CCANNNNNNNNNTGG	1 cut(s)	463
XmiI	GTMKAC	1 cut(s)	1066
XmnI	GAANNNNTTC	2 cut(s)	483, 692
XspI	CTAG	7 cut(s)	599, 714, 767, 890, 1080, 1188, 1470
ZrmI	AGTACT	1 cut(s)	149

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.