Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr17

Orthogroup ID

OG0012135

Physical Location & Seq

Genomic Coordinates Reverse (-)

14548364 .. 14549662

Gene Structure 1299 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD17G1154100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

ATGGCTGCAACATGTTGCTTTTCTCCTGCTTCCACCTCCATCCAAAAATCTGGGCCAGTTTTAAAGCCTTTCAGCAGAGTTTTGAGGTTTAAAAACAGTCTACTAACAGTCAAGATCAAAAGCTCTACCCTCCAGATCAGATCCTCCTTGAGAGAAGAGGTTTTTGAGGATCGGGCCAATGGAATAATATGCTACAAGGATGACAGAGGGGAGATAATTTGTGAAGGGTTTGATGAGGGTCCTAGGTATCACCAACATAAGCCAACAACACCTTGGCAACCCAGCAGAGACGCAGAGATCTTTGATCTTCTTCAACAAAGGTGGATTAATTTTATAACAGACACAGAATTGTGCCGTGGCGATAAAGGCAGTGCATTTCAGCAAGAGGACATAAAGAACTGCAATGGCTCCAACACTCTCCGCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

142

Amino Acids

16.08

Weight (kDa)

8.24

Isoelectric Point (pI)

43.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012135)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G14280
fragaria_vesca	FvH4_6g35780
malus_domestica	MD09G1173200.v1.1 MD17G1154100.v1.1
prunus_persica	Prupe.3G031300_v2.0.a1 Prupe.3G031300_v2.0.a1
pyrus_communis	pycom09g09060 pycom17g14680
rosa_chinensis	RchiOBHm_Chr2g0147821
rosa_laevigata	RLG00000020281
rosa_multiflora	Rmu_sc0000308.1_g000047
rosa_roxburghii	Rroxscaffold_2G00099320
rosa_rugosa	Rorug02G0402000 Rorug02G0402100
rosa_samantha	Rh2AG459100 Rh2BG472400 Rh2CG446500 Rh2DG481400
rosa_wichuraiana	Rw2G037550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	335
AccI	GTMKAC	1 cut(s)	100
AciI	CCGC	1 cut(s)	421
AclWI	GGATC	2 cut(s)	135, 177
AflIII	ACRYGT	1 cut(s)	11
AgsI	TTSAA	1 cut(s)	314
AluBI	AGCT	1 cut(s)	123
AluI	AGCT	1 cut(s)	123
Alw26I	GTCTC	1 cut(s)	282
AlwI	GGATC	2 cut(s)	135, 177
AoxI	GGCC	2 cut(s)	53, 174
ApeKI	GCWGC	1 cut(s)	5
AseI	ATTAAT	1 cut(s)	327
AspA2I	CCTAGG	1 cut(s)	242
AspS9I	GGNCC	3 cut(s)	53, 174, 239
AsuHPI	GGTGA	1 cut(s)	242
AvaII	GGWCC	1 cut(s)	239
AvrII	CCTAGG	1 cut(s)	242
BccI	CCATC	1 cut(s)	47
BceAI	ACGGC	1 cut(s)	339
BcoDI	GTCTC	1 cut(s)	282
BfaI	CTAG	1 cut(s)	243
BglII	AGATCT	1 cut(s)	297
BisI	GCNGC	1 cut(s)	6
BlnI	CCTAGG	1 cut(s)	242
BlsI	GCNGC	1 cut(s)	7
Bme18I	GGWCC	1 cut(s)	239
BmgT120I	GGNCC	3 cut(s)	53, 174, 239
BmiI	GGNNCC	2 cut(s)	240, 409
BpmI	CTGGAG	1 cut(s)	116
BpuEI	CTTGAG	1 cut(s)	169
BsaJI	CCNNGG	3 cut(s)	242, 272, 355
Bse1I	ACTGG	1 cut(s)	56
Bse3DI	GCAATG	1 cut(s)	409
BseDI	CCNNGG	3 cut(s)	242, 272, 355
BseGI	GGATG	2 cut(s)	39, 205
BseMI	GCAATG	1 cut(s)	409
BseNI	ACTGG	1 cut(s)	56
BseYI	CCCAGC	1 cut(s)	281
BshFI	GGCC	2 cut(s)	55, 176
BsmAI	GTCTC	1 cut(s)	282
BsmBI	CGTCTC	1 cut(s)	282
BsnI	GGCC	2 cut(s)	55, 176
Bsp143I	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
BspACI	CCGC	1 cut(s)	421
BspANI	GGCC	2 cut(s)	55, 176
BspLI	GGNNCC	2 cut(s)	240, 409
BspPI	GGATC	2 cut(s)	135, 177
BsrDI	GCAATG	1 cut(s)	409
BsrI	ACTGG	1 cut(s)	56
BssECI	CCNNGG	3 cut(s)	242, 272, 355
BssMI	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
BssT1I	CCWWGG	2 cut(s)	242, 272
Bst4CI	ACNGT	2 cut(s)	98, 109
Bst6I	CTCTTC	1 cut(s)	150
BstDSI	CCRYGG	1 cut(s)	355
BstF5I	GGATG	2 cut(s)	39, 205
BstKTI	GATC	6 cut(s)	117, 138, 143, 172, 300, 307
BstMAI	GTCTC	1 cut(s)	282
BstMBI	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
BstMWI	GCNNNNNNNGC	1 cut(s)	366
BstNSI	RCATGY	1 cut(s)	15
BstX2I	RGATCY	2 cut(s)	140, 297
BstXI	CCANNNNNNTGG	1 cut(s)	50
BstYI	RGATCY	2 cut(s)	140, 297
BsuRI	GGCC	2 cut(s)	55, 176
BtgI	CCRYGG	1 cut(s)	355
BtsCI	GGATG	2 cut(s)	39, 205
BtsI	GCAGTG	1 cut(s)	376
BtsIMutI	CAGTG	1 cut(s)	376
Cfr13I	GGNCC	3 cut(s)	53, 174, 239
CseI	GACGC	1 cut(s)	299
CspCI	CAANNNNNGTGG	2 cut(s)	302, 337
CviAII	CATG	1 cut(s)	12
CviJI	RGCY	7 cut(s)	5, 55, 67, 123, 176, 262, 408
CviKI_1	RGCY	7 cut(s)	5, 55, 67, 123, 176, 262, 408
DpnI	GATC	6 cut(s)	116, 137, 142, 171, 299, 306
DpnII	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
DraI	TTTAAA	2 cut(s)	63, 91
Eam1104I	CTCTTC	1 cut(s)	150
EarI	CTCTTC	1 cut(s)	150
Eco130I	CCWWGG	2 cut(s)	242, 272
Eco47I	GGWCC	1 cut(s)	239
EcoO109I	RGGNCCY	1 cut(s)	239
EcoT14I	CCWWGG	2 cut(s)	242, 272
ErhI	CCWWGG	2 cut(s)	242, 272
Esp3I	CGTCTC	1 cut(s)	282
FaeI	CATG	1 cut(s)	15
FaiI	YATR	5 cut(s)	13, 190, 258, 335, 392
FatI	CATG	1 cut(s)	11
FblI	GTMKAC	1 cut(s)	100
Fnu4HI	GCNGC	1 cut(s)	6
FokI	GGATG	2 cut(s)	26, 212
Fsp4HI	GCNGC	1 cut(s)	6
FspBI	CTAG	1 cut(s)	243
GluI	GCNGC	1 cut(s)	6
GsaI	CCCAGC	1 cut(s)	285
GsuI	CTGGAG	1 cut(s)	116
HaeIII	GGCC	2 cut(s)	55, 176
HgaI	GACGC	1 cut(s)	299
Hin1II	CATG	1 cut(s)	15
HphI	GGTGA	1 cut(s)	242
Hpy166II	GTNNAC	1 cut(s)	101
Hpy188I	TCNGA	1 cut(s)	140
Hpy188III	TCNNGA	2 cut(s)	112, 133
Hpy8I	GTNNAC	1 cut(s)	101
HpyAV	CCTTC	1 cut(s)	218
HpyCH4III	ACNGT	2 cut(s)	98, 109
HpyCH4V	TGCA	3 cut(s)	8, 374, 402
HpyF10VI	GCNNNNNNNGC	1 cut(s)	366
Hsp92II	CATG	1 cut(s)	15
Kzo9I	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
LmnI	GCTCC	1 cut(s)	413
LpnPI	CCDG	5 cut(s)	36, 39, 69, 146, 295
MaeI	CTAG	1 cut(s)	243
MalI	GATC	6 cut(s)	116, 137, 142, 171, 299, 306
MboI	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
MboII	GAAGA	3 cut(s)	167, 299, 302
MflI	RGATCY	2 cut(s)	140, 297
MluCI	AATT	3 cut(s)	216, 328, 347
MnlI	CCTC	9 cut(s)	46, 78, 140, 151, 154, 160, 200, 229, 379
MseI	TTAA	3 cut(s)	62, 90, 327
MwoI	GCNNNNNNNGC	1 cut(s)	366
NdeII	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
NlaIII	CATG	1 cut(s)	15
NlaIV	GGNNCC	2 cut(s)	240, 409
NspI	RCATGY	1 cut(s)	15
PciI	ACATGT	1 cut(s)	11
PkrI	GCNGC	1 cut(s)	7
PpuMI	RGGWCCY	1 cut(s)	239
PscI	ACATGT	1 cut(s)	11
PshBI	ATTAAT	1 cut(s)	327
PsiI	TTATAA	1 cut(s)	335
Psp5II	RGGWCCY	1 cut(s)	239
PspFI	CCCAGC	1 cut(s)	281
PspN4I	GGNNCC	2 cut(s)	240, 409
PspPI	GGNCC	3 cut(s)	53, 174, 239
PspPPI	RGGWCCY	1 cut(s)	239
PsuI	RGATCY	2 cut(s)	140, 297
SaqAI	TTAA	3 cut(s)	62, 90, 327
SatI	GCNGC	1 cut(s)	6
Sau3AI	GATC	6 cut(s)	114, 135, 140, 169, 297, 304
Sau96I	GGNCC	3 cut(s)	53, 174, 239
SetI	ASST	7 cut(s)	38, 89, 125, 162, 248, 274, 323
SinI	GGWCC	1 cut(s)	239
SmlI	CTYRAG	1 cut(s)	148
SmoI	CTYRAG	1 cut(s)	148
Sse9I	AATT	3 cut(s)	216, 328, 347
SsiI	CCGC	1 cut(s)	421
SspMI	CTAG	1 cut(s)	243
StyI	CCWWGG	2 cut(s)	242, 272
TaaI	ACNGT	2 cut(s)	98, 109
TasI	AATT	3 cut(s)	216, 328, 347
Tru1I	TTAA	3 cut(s)	62, 90, 327
Tru9I	TTAA	3 cut(s)	62, 90, 327
TscAI	CASTG	1 cut(s)	376
TseI	GCWGC	1 cut(s)	5
TspRI	CASTG	1 cut(s)	376
VpaK11BI	GGWCC	1 cut(s)	239
VspI	ATTAAT	1 cut(s)	327
XceI	RCATGY	1 cut(s)	15
XcmI	CCANNNNNNNNNTGG	1 cut(s)	270
XmaJI	CCTAGG	1 cut(s)	242
XmiI	GTMKAC	1 cut(s)	100
XspI	CTAG	1 cut(s)	243

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.