Rh2CG446500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
60479001 .. 60480693
1693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG446500.1

Sequence Viewer

Length: 333 bp
ATGGCTGTTACTTGTTCTCTTCCTCCTTGTTTCTCAATCCTAAAATCTGGTCCTGCTATAAAGCCTTTCAGCTCAGTTTTGAGGCTTAAACACACTTCTCAAGTCACAGTGCTCAAGAAAAGAACATCTGCAGTGCTCAAAATCAGATCTTGCTTCAGAGAAGAGGTTTTCGAGGATCGCTCCAACGGAATAATCTGCTACAAAGATGCCAGAGGGGAGATTATTTGCGAAGGATACGATGAAGGCCCTCGATATCACCACCAGAATCAAAGAATAGTTAATCAATCAAGGTACAAAAAAAAAGAAAAAAGGAAGAAGCATGGAAACATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.68

Weight (kDa)

9.9

Isoelectric Point (pI)

41.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012135)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 183
AcuI CTGAAG 1 cut(s) 139
AfaI GTAC 1 cut(s) 293
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
Alw21I GWGCWC 2 cut(s) 114, 138
AlwI GGATC 1 cut(s) 183
AoxI GGCC 1 cut(s) 244
AspS9I GGNCC 2 cut(s) 50, 245
AsuHPI GGTGA 1 cut(s) 248
AvaII GGWCC 1 cut(s) 50
Bbv12I GWGCWC 2 cut(s) 114, 138
BciVI GTATCC 1 cut(s) 227
BfmI CTRYAG 1 cut(s) 129
BfuI GTATCC 1 cut(s) 227
BglII AGATCT 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 50
BmgT120I GGNCC 2 cut(s) 50, 245
BmsI GCATC 1 cut(s) 196
BplI GAGNNNNNCTC 2 cut(s) 164, 196
BpuEI CTTGAG 2 cut(s) 84, 98
BseMII CTCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 246
BsiHKAI GWGCWC 2 cut(s) 114, 138
BsnI GGCC 1 cut(s) 246
Bsp1286I GDGCHC 2 cut(s) 114, 138
Bsp143I GATC 2 cut(s) 146, 175
BspANI GGCC 1 cut(s) 246
BspCNI CTCAG 1 cut(s) 86
BspMAI CTGCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 183
BssMI GATC 2 cut(s) 146, 175
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 2 cut(s) 24, 156
BstDEI CTNAG 1 cut(s) 73
BstKTI GATC 2 cut(s) 149, 178
BstMBI GATC 2 cut(s) 146, 175
BstSFI CTRYAG 1 cut(s) 129
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
BsuI GTATCC 1 cut(s) 227
BsuRI GGCC 1 cut(s) 246
BtsI GCAGTG 1 cut(s) 138
BtsIMutI CAGTG 2 cut(s) 114, 138
Cfr13I GGNCC 2 cut(s) 50, 245
Csp6I GTAC 1 cut(s) 292
CviAII CATG 1 cut(s) 320
CviJI RGCY 5 cut(s) 5, 64, 72, 85, 246
CviKI_1 RGCY 5 cut(s) 5, 64, 72, 85, 246
CviQI GTAC 1 cut(s) 292
DdeI CTNAG 1 cut(s) 73
DpnI GATC 2 cut(s) 148, 177
DpnII GATC 2 cut(s) 146, 175
Eam1104I CTCTTC 2 cut(s) 24, 156
EarI CTCTTC 2 cut(s) 24, 156
Eco32I GATATC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 50
Eco57I CTGAAG 1 cut(s) 139
EcoO109I RGGNCCY 1 cut(s) 245
EcoRV GATATC 1 cut(s) 254
FaeI CATG 1 cut(s) 323
FaiI YATR 2 cut(s) 59, 321
FatI CATG 1 cut(s) 319
HaeIII GGCC 1 cut(s) 246
Hin1II CATG 1 cut(s) 323
HinfI GANTC 1 cut(s) 265
HphI GGTGA 1 cut(s) 248
Hpy188I TCNGA 2 cut(s) 146, 158
Hpy188III TCNNGA 1 cut(s) 115
HpyAV CCTTC 2 cut(s) 224, 236
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 73
Hsp92II CATG 1 cut(s) 323
Kzo9I GATC 2 cut(s) 146, 175
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 4 cut(s) 33, 66, 223, 275
LweI GCATC 1 cut(s) 196
MaeIII GTNAC 2 cut(s) 7, 103
MalI GATC 2 cut(s) 148, 177
MboI GATC 2 cut(s) 146, 175
MboII GAAGA 3 cut(s) 11, 173, 325
MflI RGATCY 1 cut(s) 146
MhlI GDGCHC 2 cut(s) 114, 138
MmeI TCCRAC 1 cut(s) 207
MnlI CCTC 6 cut(s) 33, 75, 157, 166, 206, 258
MseI TTAA 3 cut(s) 87, 279, 331
NdeII GATC 2 cut(s) 146, 175
NlaIII CATG 1 cut(s) 323
NmuCI GTSAC 1 cut(s) 103
PfeI GAWTC 1 cut(s) 265
PspPI GGNCC 2 cut(s) 50, 245
PstI CTGCAG 1 cut(s) 133
PsuI RGATCY 1 cut(s) 146
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
SaqAI TTAA 3 cut(s) 87, 279, 331
Sau3AI GATC 2 cut(s) 146, 175
Sau96I GGNCC 2 cut(s) 50, 245
SduI GDGCHC 2 cut(s) 114, 138
SetI ASST 3 cut(s) 74, 168, 293
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 50
SmlI CTYRAG 2 cut(s) 99, 113
SmoI CTYRAG 2 cut(s) 99, 113
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 2 cut(s) 171, 250
TfiI GAWTC 1 cut(s) 265
Tru1I TTAA 3 cut(s) 87, 279, 331
Tru9I TTAA 3 cut(s) 87, 279, 331
TscAI CASTG 2 cut(s) 114, 138
TseFI GTSAC 1 cut(s) 103
Tsp45I GTSAC 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 255
TspGWI ACGGA 1 cut(s) 201
TspRI CASTG 2 cut(s) 114, 138
VpaK11BI GGWCC 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.